Detailed Information [104342]
Strain Information
DGRC Number 104342
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Btk29A[NP3020]
w*; P{w+mW.hs=GawB}Btk29ANP3020
Break points/Insertion Site 29A1
Map Viewer
Related Genes Btk29A tRNA:K5:29A mir-2b-1
Original Number 3020
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3020

NP line. Received from the National Institute of Genetics.

Cluster id 1107
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression many mesoderm, cns, other,
Larval GFP sg, foregut
Larval X-gal tr
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33685_0907
Strand Plus
Insertion Point 8268822
Chromosome Band 2L
Flanking Sequence
cgtgcactnaattttgtgtatacttcggtaagcttcggctatcgacgggaccaccttatg
ttatttcatcatgGCTCGAANGCGCCCCTCACTTTGCTAATNGGTTTGGNTGCAAAGAGA
GAATCAATNTAANGGGAGACAGGTAGAAAACCGATTAAGAATTAACAAAGAAAATGATTC
GAAGTTAGNTACTTGTGACTAAAAATAAAGAACTATTTTAGTCGTTGCGAAATATTTATT
TTCGTAACTTGCANANAAAATGNACCANCTAAAANGTTNTNAAAGNTACCCGTCGAATGA
AATGNGATTGATCGNAGANNNCCTAAGANNGNNCCGNTGTCCAGAACCCNTTATNTGTTG
GCGGTCGTTNTCNNGAANGGCACCCANACANATGCAAGNCGGNTCAGGCCGAAAAAACCC
TGGTAGTTTCCTGGGATAAAACTGACGTATNGGGGGGTTTCTTGAGGGGNGCCGGAAATG
ATCAANACCTGGGNTGACCGTGNACAAANTGTTTGANAAACGCCCACTTAATTTCCGGCC
NNAGGAAAGNAANAACCCTCCCCTNTCAAATNTTTTTGNNNNNNAAAANNNAAAAAACCC
CNNCCNAAAACCCTNTTTNGGGGGCCCTTTTNGANNGGGNNCCCCCCCANTTNTNNNNTT
TNNNCCNAAAAANNNNGNNNGNCCCNGGGGNNAAAANCCCNNNNNNNGGGGNTTTTTNNA
NNNNGNCNNNNNNANNNNNNCNNNNNAANNNNNNNNCCTTTNNNNNNCNNNNTNNTCNNN
NNNNNNNNNCCCNNTTTTTTtnncnnnnnnnnnnannnnnaanannnnnccccnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnn

CLOSE