Detailed Information [104363]

Strain Information
DGRC Number 104363
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG12054[NP3071]
Genotype w*; P{w+mW.hs=GawB}CG12054NP3071
Break points/Insertion Site 100B3
Map Viewer
Related Genes CG12054 CG15563 CG1746
Original Number 3071
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3071

NP line. Received from the National Institute of Genetics.

Cluster id 1696
General Information NP_lines
Embryonic Expression stripes in lateral epi, pns (ch+others, TU), useful driver
Larval GFP cns, pns
Larval X-gal oenocyte, gut, tr
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34655_0907
Strand Minus
Insertion Point 27038530
Chromosome Band 3R
Flanking Sequence
TTGNTCTTCGGNAGCTTCGGCTTCGACGGGACCCCTTATGTTATTTATCATGGTTTACTG
CGGCAGTTAGCCTTTCGCAGCTGGTTATCTAAATGCGAGTGCAGAAACACTCATAAATAA
ATTATCCCGGGCATTTTCGGGACCGTACAACAGGTGCCTGGCAACTGTGAAAAGGACAAA
CCTGAAGGTCTCGCCGCCTTTTGCGTTGCCATGACAACCGAATCGAGCCGAAACGAAGCG
ACAACGCCCACTGAGTCCTGATAACAGGCACACATTCCATATTCCATGCACCCAGCCATN
CATCCAACCATTCCATTCCACTCAGGGAACCCACGCATTCGAATGGTCTTNGAGATAATG
AAATGATGGGCATTTATAAGCCCTANAACAGNTNGCTNACGTAATGGATACCCAATGGAT
GNGGGGAAATGGGCAAACCGGGGATGCCGGGTTTTCGGGGCCTTGGGCGTATTTGGTATT
TTGGGCCTGGGCCAATTTNGGGGTGGCAGGTGGCAAGNGGGCGTNTGCCCGNGNCTGGGC
TTTATGGNATGGCCCCGGANCCAAAAAGGGGNNGNNGCTNNGNNGGAAAGNCTTGCCCGG
CAGNCANTTTTNTTTTCNAGGGGGCGGGTGTGTGTGTTTGANCGGTNTTACCCCANNAGG
GGGAAAAANNAAAAAAGTTGGCAACCCAAATTNGNAGGTTNACAACCCCTTTTGTTTTTT
TTTTTTTCAANCCCTTTTTTTTAACGNNTTGTTNAAAAANANCCTNNTTTTGGCCCACAN
AAAAAAAATTGAANGGGCAAaggggnaattnaaaaaaccggngtgnccccnccccgtttn
naaaaaggggggggagtnttttggaaaaanccnantttttnattgggccccttnaaagaa
aanaaaaag


CLOSE