Detailed Information [104368]
 

Strain Information
DGRC Number 104368
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Pitslre[NP3083]
Genotype w*; P{w+mW.hs=GawB}PitslreNP3083
Break points/Insertion Site 77E6
Map Viewer
Related Genes CG4042 Pitslre
Original Number 3083
Chromosome 3
Comments Tb, TM6B floating. 29Jun2017 T.O.
FlyBase Insertion: P{GawB}NP3083

NP line. Received from the National Institute of Genetics.

Cluster id 2008
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg
Larval GFP sg, gut
Larval X-gal central pouch,
Adult GFP ubiquitous
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34765_0907
Strand Plus
Insertion Point 20689574
Chromosome Band 3L
Flanking Sequence
tttngtgcactgaatttaattgtatacttcggtaagcttcggctatcgacgggaccacct
tatgttatttcatcatgCACCACAAGAAAAAAGAAGAGAAGAAAGAAACGCAGACGACCT
TTTGCTGAAGTGCGTGAGATACCACCGAAAAAACGAACCAAATCAATTAAATGCTGATTA
ACCGCCAGCCAAACGATTGAAAACAACGGTAGCCAGGCGAACGCCGCAGAAACCTGCCAA
CAATTACGTGAACCAACGCAAGGGCACCCGTGCAATTGGCATTTTAATTGGCGACTTTAG
CTGCGAACGGCGCGCCGAAAATGGTCAATTCGTCTGGCAGCGAGGATGGCCAGTTGCGGA
GCCCCAACGATGTGCACTATCACAGGTGTGTATTATCCCTGGGGGTCCTGGGAAAACTCA
GATATTCGGTGTTCTCAAAATGCGATTGGAAAATTGTTGCTGCATACATACATAAAGAGG
CGTACATATACACATGCTGGTGCTGGTGGCGCGGCGGGAATTCCGCTAGAACTCTAGCCA
GATTTTTTTGTGGCATNCCACCGTTGACATATCCCGCCCATTCATACAGCTGTGGTCATG
ATAGTAGTGGGTACCGGGTTTTTTAAAAGAATACCATAAANTATTTTTTgatcgaagaat
acataagagagaaccgtnnccnaagaacccattattgntgggggtccgttttcaggaagg
gcaagccattccacatgttattctttttagacccattcaaattccttgaaggagcattcc
ttgggcataaaatccaacgggatttgngggggttnttnatgatgagctgccnagttaatc
gatacagtnaactggcttttgaccctttggtactactnttttncgaggatgatggcgnac
tttattntntgctggcntnaat

Image Files
Disc

d1 (->Large)

CLOSE