Detailed Information [104384]
 

Strain Information
DGRC Number 104384
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Mi-2[NP3126] / TM6, Sb[1] Tb[1]
Genotype w*; P{w+mW.hs=GawB}Mi-2NP3126 / TM6, Sb1 Tb1
Break points/Insertion Site 76D3
Map Viewer
Related Genes Ell Mi-2 CR32216 CR32218
Original Number 3126
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3126

NP line. Received from the National Institute of Genetics.

Balancer TM6 Sb Tb
Cluster id 1992
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression ubiquitous
Larval GFP sg
Larval X-gal fb, gut, mt, epi, tr
Adult GFP ubiquitous
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np35155_0907
Strand Plus
Insertion Point 19814564
Chromosome Band 3L
Flanking Sequence
ggggcccgnggngnangtttttttttgggnnacttggggcactgaancttaattgtatac
ttncggtaagcttcggctatcgacgggaccaccttatgttatttcatcatgCTTGTACAC
TTAAATCTTTCTTTGCACACGCACACTAATTTTCAGCACTTTAAATATTGTTTGATTTTA
ATGCCTTTTAACCACTTTTTGTGCTGCTTTTGTATTGGCTGGCGGACACACACGAATACA
TATATCTATTTCTATATTATACGTACGCTTTACGCGTATGCGACACTTTTACTCAAGACA
TTTTTGGTCAAGTGGATTTTGGTGNACATTCATTTGGAGAACCGGTTCTGAATTTATCGA
GTTGACTTCTTAATATTTTANGGGGNTTTTTAAGGGCAGTTTTTAGCTGGCCTTTTNTTT
TTTTGGAGGGGGGTNTGGGGGGNGNCCAAGGGTNTTTTAATCAACGGCCAAAANGGGTTN
NGGTAAAAGNAANCNAAAAGGGGTGGTTTTTAAAGGGGGGTGCCCCNNCCAAANGGNGNG
GGGGGGGGGGGNAACCNGGGGGGGGGGNACCNGGNTNTTTTTTGGGCCCNNNNTTTTTTN
AANANNGGGGANAAAAACCGGGNANTTNNNNGGGGGGGGNNNNNTTTNNNAAACNCCNCT
TTGGGNGGGNNCCCCNCCCCCNCCAAANAACCCCCNNNNTTTGNGGGGGGGGGCCCCNNT
TTTNANGGGGGGGGGGGNGCCCCCCCCCCCCCGGGNTTNNTCNTTTTTGNGCNCCCNNNN
NTTTTCCCNGGNGGGNGNTCccccnngggnnaaaaaannccacnccggnggggggggggt
ttnnaaatanggggnggncggnncgnnnnnnntnnnnnnnantaagngnnnnnnnnnnnn
nnaanacnnntttttnggnngggggggggnncccctnttttttttttnntntaaananan
gggngnnannanncccccnnggaacnaaaanannntnnnnn

CLOSE