Detailed Information [104390]
Strain Information
DGRC Number 104390
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP3141
y* w*; P{w+mW.hs=GawB}NP3141
Break points/Insertion Site 39E5; -; 39E6
Map Viewer
Related Genes cul-2 Doc{}510 invader4{}511
Original Number 3141
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3141

NP line. Received from the National Institute of Genetics.

Cluster id 1299
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression epi
Larval GFP fb, mt, gut
Larval X-gal fb, gut, mt, epi
Adult GFP wing margin, abd
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np35255_0907
Strand Minus
Insertion Point 21486508
Chromosome Band 2L
Flanking Sequence
atctttgggtgcactgactttntttgtntacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgATCGAANAATACATAAGAGAGAACCGTGGCCAAAGAACC
NATTATTGTNGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATNCTNTTCAN
ACCAANNAAATCCATGAAGAGCATCNCTGGGCATAAAATNCAACGGNATTGTGGAGTTAT
CATGATGAGCTGCCGAGTCAATCNNTACAGACNACTGNNTTNGACCTTTGCTACTACTCT
CTTNCGANGATGATGTCGNACTTATTCTATGCTGACTCAATGTTAGAGGCATATCANACT
CCANTGAAGCCATCTTATGNGGGGGNNNNGNGTTAAAAAATATAGNCTCATTTGAGGTAA
AGCGGAATTCGTTTCATTATTGNGTAATTCGTGGGAAAATTGTAAGGCTTATGCAAGGCA
CTTCTGTCATATGGGAgatcgaagaatacataagagagaaccgtngccaaagaacccatt
attgntggggngcgttttaggaagggcaagccatccgacatgtcatccttctttagacca
atcaaatccatgaagagcatcccctggncttaaaatccancggaattgnggngttatcat
gatgagcttgcccgagtnatcgtnccagnnaantgnnttngnncctntngtcctacntnt
ctttccnngatgatgncncacntnttnctatgctgntnttaatgttngaggcctntnant
ctccctgagcctnttnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnttntntntcnnnccntntnnnnnncnnnnnnnnnnnnnnnnnnnnnna
na

CLOSE