| Strain Information | |
|---|---|
| DGRC Number | 104398 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}Trl[NP3173] / TM6, Sb[1] Tb[1] |
| Genotype | w*; P{w+mW.hs=GawB}TrlNP3173 / TM6, Sb1 Tb1 |
| Break points/Insertion Site | 70F4 |
| Map Viewer |  |
| Related Genes | CG13470 Trl |
| Original Number | 3173 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP3173 NP line. Received from the National Institute of Genetics. |
| Balancer | TM6 Sb Tb |
| Cluster id | 1908 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Embryonic Expression | muscle |
| Larval GFP | uniform epi, tr. |
| Larval X-gal | ubiquitous |
| Adult GFP | strong internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np35465_0907 |
| Strand | Plus |
| Insertion Point | 14707860 |
| Chromosome Band | 3L |
| Flanking Sequence | aatttttagcgtgcactgaatttanntgtatacttcggtaagcttcggctatcgacggga ccaccttatgttatttcatcatgCTACGGGGTAAAAACATATAGCCAGTCTCATTCTCGT ATGCAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggt ccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccat gaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccg agtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatg tcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgaagccatct tttttnttggggnnnnnnnnnnntnnnnnnnnnngangnnnnnncntnatttntntgnct nnnntnaaangntnnnanggcntatnnnnnctncactgangccagatnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |