Detailed Information [104452]

Strain Information
DGRC Number 104452
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Clc[NP3320]
Genotype w*; P{w+mW.hs=GawB}ClcNP3320
Break points/Insertion Site 77A3
Map Viewer
Related Genes CG17233 Clc CG6951
Original Number 3320
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3320

NP line. Received from the National Institute of Genetics.

Cluster id 2000
General Information NP_lines
Embryonic Expression weak, muscle
Larval GFP fb
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np36725_0907
Strand Plus
Insertion Point 20160299
Chromosome Band 3L
Flanking Sequence
gtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggaccaccttatg
ttatttcatcatgTGCTATGCAATAGCAACAAGTGTTGTATAATACGCTTTTTATCGGGT
CTACAGTCATTACTAGTTAACTTTGTTGTGTATTTACATTTTACGAGCATTTATTAAGGC
ACATTTGATAAGATATAAACAAATTAATCGTAACTCCTCTGAAGGTTGTGTTTACTGAAC
TCGCGCGTTTCCTAACACTgatcgaagaatacataagagagaaccgtcgccaaagaaccc
attattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctctttaga
ccaatcaaatccatgaagagcatcccctgggcataaaatccaacgggaattgtggagtta
tcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttggtactactc
tcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtc
tccactgagctttttttttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE