Detailed Information [104457]

Strain Information
DGRC Number 104457
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}IP3K1[NP3331] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}IP3K1NP3331 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 30C9
Map Viewer
Related Genes CG18854 CG4026 CG4110
Original Number 3331
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3331

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1137
General Information NP_lines
Lethality lethal
Embryonic Expression mesoderm from stg 9? muscle
Larval X-gal proximal ring of wing/haltere discs, fb, epi, gut, mt
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np36845_0907
Strand Minus
Insertion Point 9774813
Chromosome Band 2L
Flanking Sequence
tgtcancgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgggaccaccttatgttatttcatcatgCACTGTGCCTTCCA
CATGGGAGAACTTCGCTATCTTTATCTAAGTGCGCTTTGTTTTTGCACATTTATCTTTAT
CGCTCGGCTCCGTTGGGAACTGTATATATAGGCACTGACGATCGAAGAATACATAAGAGA
GAACCGGCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCC
GACATGTCATCCTCTTNAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCC
AACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTT
TGACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCACTTATTCTATGCTGNCTCAAT
GGTAGAGGCATATCAGTCTCCACTGAAGCCAATCTTATCTGGNNNNNNNNNNTNNANNNA
ANNTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnntnnnnn
nnnnnnannnnncnnnn

Image Files
Disc

d1 (->Large)
Embryo

e1 (->Large)

e2 (->Large)


CLOSE