Detailed Information [104464]
Strain Information
DGRC Number 104464
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}sm[NP3344] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
y* w*; P{w+mW.hs=GawB}smNP3344 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 56E1
Map Viewer
Related Genes CG16716 CG18367 sm
Original Number 3344
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3344

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 873
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression weak
Larval GFP strong tr, epi, pns, oenocyte
Larval X-gal oenocyte, tr
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np36745_0907
Strand Plus
Insertion Point 14683765
Chromosome Band 2R
Flanking Sequence
tttttnggcgtgcactgcaatttnnttgtatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgCGTTGAGGCCTGCTTACATAACAGCAAATAATGTTTA
AGCAGCGGTAAAGTAAAGCAAAGCCAACCCGAAAAAGCGAGAAATCGGGAAGAAGTAAGC
ACAAATAATGACAAACAATAACAAAAAAAAAANCATTNTTTTCCAAAAANGANCAAANCN
ATTTNCCCTNAAAANGGGNCAANGCCAANGTNCCAAAAAAGGNGAAAAATAAAACAAACC
CGAAAAGNGTCCTTCNNTNGNGGCNANCCCAGNTCCAGATNCANNTCCAATCGNCCANAT
CCNGCNGGTTCGCCTGCTTTTAANNATCCNTATCCAGTTNCTTTTCCGCCNGTGGNGGTT
ATTATTTTTTTGGNCCCCANNCATTCTTTTTTTTTNGGNCTTTTGGTTGGCTTTAAAAAN
TTGGAAAANNCTGGGNCCGTAANNGGTTTTCGNGGGGTTTTGGGGTCAAAAATAAAGGGG
GGGGGNCCNATTTNNTNCTAACCCCNAGCAANTGGCTTAANNANCGTTTTNTTTGNGGGN
CCCTTTTGGAAANNAATTANTTNGGGCNNNANANGGCNNCCCANNGNAAAAATTATATTT
TNGCNTTGAAACCGGCCCCNGNAGGGGATCCCGGCCAAANAGNNGGGGTNCCCAATTNCG
GNNTNGTGNAATTTNGGNCNCCNTTTGTTNNGTGGNTCNGAGNAACCNTNNAAAAGAACC
CNTCCCCCAAANANCCCNTTnttgnnngggntccntntnttggggnggnanccctncccn
cantngtttctgntngcccccntcnaattncttangagnnctcncnggnttntntnncnc
ggnnttngtgntttttttngtnncgccnccgcgttttttcccagnntgggtgtngctcnt
ngcntgtcnttnnggangnnnntcncccnttttttnctagtaannnaaacat

CLOSE