Detailed Information [104471]
 

Strain Information
DGRC Number 104471
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP3362 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP3362 / FM7c
Break points/Insertion Site 15A1
Map Viewer
Related Genes CG13010 CG13012
Original Number 3362
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3362

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 394
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression weak sg
Larval GFP gut
Larval X-gal gut
Adult GFP joint in leg, mouth. hinge, antenna, sternite, weaker in pleura. oceli.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np14365_0727
Strand Plus
Insertion Point 16404080
Chromosome Band X
Flanking Sequence
antacttggggcactgaacctattttttatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgGCCCAAACGTAACTTTCGATTGCGCCAAAAGCGGCGGC
TGCGACGCCGACTGCGCAGTCGCGAGAATGTCGAGAAAGGCGGCTTAACCCTATAAAGGC
CAAACACTTTGTTTTGGGCCAATTTAGGAACATGAAAATGANTGCAGTTAgatcgaagaa
tacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagg
gcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgg
gcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacag
tcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctat
gctgtctcaatgttagaggcatatcagtctccactgaagccatcttntttttggggnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE