Detailed Information [104481]

Strain Information
DGRC Number 104481
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}kis[NP3385] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}kisNP3385 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 21B5
Map Viewer
Related Genes CG13693 kis
Original Number 3385
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3385

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 969
General Information NP_lines
Lethality lethal
Embryonic Expression cns
Larval GFP part of gut?
Larval X-gal outer ring of wing pouch,
Adult GFP ubiquitous? internal?
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np14375_0727
Flanking Sequence
CCTTNTTTGTATACTTCGGTAAGCTTCGGCTATCGACGGGACCACCTTATGTTATTTCAT
CATGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGTCC
GTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGA
AGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAG
TCAATCGATACAGTCAACTGTCTTTGACCTTTGNTACTACTCTCTTTCCGATGATGATGT
CGCNCTTATTCTNATGCTGNCTCAATGTTAAGAGGCATATCAGTCTTCACTGNAGCCCAT
TTANTCTGGGNTNNNNNTNTNNNNNNNNCNNNNNNNNNNCNCNNNNNNNGGNGNNNNNAA
NNCNNNNNNGNNNNNNTNNNNNNNNNNANANNCNTNNGNNNNNNNNNNNNNNNNNNCNNN
NNNNNNNNNNNNNNNNCNNCTNNNNNNNNNNCNNNNNNNNNNNNNNNNGNNNNNNNNNNN
NCNNNNNGNNGNNNNNNNNNNNNNNNGNNNNNNNNNNNNGGNNNNNNNNNCGNNNNNCNN
NNNGNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTNNNTNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNN
NNTNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNTNNNNNNNNNNNNNTN
NNNNNNNNNCNNTNNNNNNNnnnntnnnnnnnnnnnnnnnnnnttnnnnnnnnnnnnnnt
nnngnnntnnncnnnnngnnnnnnncnnnnnnnnncnnnnnnnnnnnnnnnntnnnnnnn
nnnnncnnnnnnnngnnntnnntnnntnnnnnnnnnnnnnnnnnnnnnnngcttnnnncn
nnnnnnnnnnnnnnnnnnnnnnnat

Library Name / Clone Name np / np57223_0309
Strand Minus
Insertion Point 222213
Chromosome Band 2L
Flanking Sequence
CTTTTTACTGCGCACTTATCTGCAAGTCATACGTTGAGANNNTNAACCNCAGNNGCANGG
CNCNGGNTTAAGTAATCANTANTATGNTTGGNTCAGTCAGACTTNCTACTCTCCCGNGCT
CCCTNTCTTCTGAGTNTCTNTTTNTGGCTGATTCGCATTCGATTTTAGCCGCTGNCATCG
CCGTTGTTTGCCTACCTATGTGTGTGTGTGAGGAGTGTGTNTTGTATTTTAGTCCGCAAT
GCGCTCCGCTCATTATTTGTTTGAGCGCCGCGGTGTAAAGTTGTAAAAAGTCCAAGTGCT
CGTGGAAACTCGATGCAAGACGGGGAAAACGAAACGCGATAAATCGTGAGAAAGAGAGTG
CGCTAAAGGAAGAGGGAGTGATAATCAAACGAAATGGAATAATATATTTGCAGAGGCAAC
AACAACAATGCAAATAGTTGTCATTGAGGCGCAATGAATGATAATTAGTGCTTAATTGAA
ATCAATAATCATGACGAAAGCGTAAAGCTTCGATTTTGCCAATATATTCTTGATTACCAG
TGAGTCTGTGATATTGCCGTGTGTTCGAAAATGGAGGTTATTAAACCCATGGACTTCAGC
AGCTTCTCGGCGTTCTGCGAGCATCTTAACAAATCTTCACAAATTGCAGCAACAACTGCA
ACGACGATACCGNCAACAATAAACAATGGNAAAGGCATTTATTTGGAGGTAAAAGCAAAA
AANACAAATATTTCNATGCGAAAATGCAAGCATGGACATGANGCGTTTNCTAATTAAAAA
GAGAATGCAAAAATGCCNAAagnatatgcaaagaatgtgngcatgccnntagtcaanaaa
aaagggaaccagancccaaaagagtggggacanaccacnagganggggatccctacttnn
nnnnnnttgggnnncnnnnnnnnnnnnnnancnnannnnnnnnnnnnnnnnnnnnnnnnn
nnnnannnnnnnnc

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)


CLOSE