Strain Information | |
---|---|
DGRC Number | 104486 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}CG11652[NP3394] |
Genotype | w*; P{w+mW.hs=GawB}CG11652NP3394 |
Break points/Insertion Site | 68D2 |
Map Viewer | ![]() |
Related Genes | CG11652 CG6053 |
Original Number | 3394 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP3394 NP line. Received from the National Institute of Genetics. |
Cluster id | 1871 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | sg muscle. |
Larval GFP | sg, fb |
Larval X-gal | fb,stripe in epi, gut, mt |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np11055_0727 |
Strand | Minus |
Insertion Point | 11654509 |
Chromosome Band | 3L |
Flanking Sequence | attntttgggtgcantgcattttttgtatacttcggtaagcttcggctatcgacgggacc accttatgttatttcatcatgAATCAGCTGTTGTCATTCGACATTCGCACGCGGGATTGG AAAGAAATAACTAAAACGTTTTTAAAGCACGCTTAAAgatcgaagaatacataagagaga accgtcgccaaagaacccattattgttggggtccgttttnnggaagggcaagccatccga catgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaa cggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttg acctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgt tagaggcatatcagtctccactgagcatctntttttttgggggnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaggnnnnnnnnnnnnnncn gnnnnnnatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |