Detailed Information [104511]
 

Strain Information
DGRC Number 104511
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3456
Genotype w*; P{w+mW.hs=GawB}NP3456
Original Number 3456
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3456

NP line. Received from the National Institute of Genetics.

General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression pmg from stg 8
Larval GFP ubiquitous tracheal expression from L2
Larval X-gal ch
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Tastekin I, Riedl J, Schilling-Kurz V, Gomez-Marin A, Truman JW, Louis M.
Role of the subesophageal zone in sensorimotor control of orientation in Drosophila larva.
Curr. Biol. (2015) 25(11) 1448-60 [PubMed ID = 25959970] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np11575_0727
Flanking Sequence
GTTTTGGNNNGACNATGGGGGAAAAAACCCCNTNTTGGGGGNNNAAAAACCCCGCCNTTG
ACGGGACCCCTTNNTNANNNATCANGGCACGGGGTCTCTCTACAGGGCGAAATCATCGCG
AGAGAGAGCCGAGAACGGTGCGCACCTTGTAGATACGGATTGAAATACGTGCGGGTCGGT
ATCGGTATCTACGGAATACAAAATACGACAGTTGCACGTCGTTTNTTTTTTTTTGNTNCA
TTGTTATTTGGNCGGTGCTGTGGGCCGCGTTCGTTTTGTTTCGTTTATTTATAGTAATNA
AAGGCGTTCGTGAGTGGGAATAAGTTATTTAAATTGTACAACAAATAAGCCGAAAATTAA
AAACAAATTGTGTAGTTACAAGTGAGTGGATGGGCGATCGAAGAATACATAAGAGAGAAC
CGGCGCCAAAGAACCCATTATTGGTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACA
TGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACG
GAATTGNGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGGCAACTGGCTTTGAC
CTTTGGTACTACTCTCTTCCGANGATGATGGCGCACTTATTCTATGCTGGCNCAATGGTA
GAGGCATATCAGNCTCCACTGAAGCCATCCNAAANNGGGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNGGNNNNNNNNNNNNNNNNNNNNN
NCNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnn
nnnnnnngnnnnnnnnnnnnnnngngnnnnagnnnnnnannnnannnannnnnnan

CLOSE