Detailed Information [104556]
 

Strain Information
DGRC Number 104556
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Gug[NP3609] / TM6, Sb[1] Tb[1]
Genotype w*; P{w+mW.hs=GawB}GugNP3609 / TM6, Sb1 Tb1
Break points/Insertion Site 66C13; -; 66D1
Map Viewer
Related Genes CG6915 Gug CG6983
Original Number 3609
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3609

NP line. Received from the National Institute of Genetics.

Balancer TM6 Sb Tb
Cluster id 1828
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression cns
Larval GFP midgut
Larval X-gal sg, mg
Adult GFP internal abd
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Liu J, Gong Z, Liu L.
-glutamyl transpeptidase 1 specifically suppresses green-light avoidance via GABAA receptors in Drosophila.
J. Neurochem. (2014) 130(3) 408-18 [PubMed ID = 24702462] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34425_0907
Strand Minus
Insertion Point 8414547
Chromosome Band 3L
Flanking Sequence
nttttnggtgcactgacttttttgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgAGCCAAATAAACGACCCACAACGCTGCCACTGTACTCGCCT
CCTCCGACTAACCTGTGCTCTCTAGGGTGGACCTTCTATGGGTTCTAATCCGAATATAAC
GCTTTTATAATCTACTTTTATGCTTTTCAAATAAAAACACAAATTGAAATCTGATTTATA
CCCAATTTTTTCTTCTGTTCATTTATATGTTGAAAATACCCACACATAATTATTATTGTA
TATACTTTTATACAATTGCTAAAAAATGCCAGTTATAAAAACTTGTTAACAACCCAAGCG
AAACCATTTAGCATAAATTTAATAAGCCCTTAATCTAATTATTTCGCGTTTAATGACACC
CATAAACCACGAGACCAAGGTCCACCCCAGGTGCAAATATCCATTGGCCCgatcgaagaa
tacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagg
gcaagccatccgacatgtcatnctcttcagaccaatcaaattcatgaagagcatccctgg
gcataaaatccaacggaattgtggagntatcatgatgagctgccgagtcaatcgatacag
tcaactgncttgaccnttggtactactctcttccgatgatgatgtccgcacttattctnt
gctgnctcaatgttagaggcatatcagtctncactgagcatatttntntttgggnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnncntnnnnnnnnntnnncnnnnngnnnnnnnnnnnt
tnnnnccnnnnngnnnnnnnnnnnnnnnntnnnnnnnnnnnnnncnnnntnnnnnnnnnn
nnnncncanaann

CLOSE