Detailed Information [104567]
 

Strain Information
DGRC Number 104567
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}NP4005 w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}NP4005 w* / FM7c
Break points/Insertion Site 2D2
Map Viewer
Related Genes ph-d FB{}23
Original Number 4005
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP4005

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 58
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns (SG), a small number of cells (TU)
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np13545_0727
Flanking Sequence
AGGGNNNGGNGNGGNGNGNNNNNNGNGGGGGGNGAGGGNNGNGNNGTNTTTTGGNNNGGG
ANNNNGNNGGGAAAAANCCCCATTTTTNGGGGNNNNNAAAAAACCCTNNNNNTTTGNGGG
NNNNNNNTTTTTGGGGGNNNNNNNGNNNNGGGGGNNNGGGNNNNNNNNNNNNNNNNNNNN
NNNGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNTTTTTTTTTTNNNNN
NNNNNNNNNTTGNGGGGGGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNN
NNNNNNNNNNNNGNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNGGNGNNGNNNNNNNNN
NNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNGNNNNNNN
GNNNNNGNGGNNNNGGNNNNGGGGNGNGNGGGGNNGGGNNGNNNGGNNNNGNNNNNNNNN
NNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNGGNNNNNNNNNGGNNNN
NNGNNNNGGNNGNNNNNGGGNNNNNNNGNNGNNNNNNGGGNNGNGGGGGNGNNNNNNNGN
NGNNGGGGNNNNGGGNNNNNnnngnnggngnnnnnnnnnnngnnnngnnnnnnnnggggn
ggnnnnnnngnnnnnggggnngnnngnggnnngnggggnngnggngngngngnnnnnggn
gnngnnggnngngnnnngnnnggnggnnnggggnnnnnnnnnnngnnnnnnnnnnngngg
nngnnnnngngngnngnngnngngngnnnngngnnnnngnnnnngnnnnnnnnngnggnn
gngnggngnngggnnnngggggggggnnnnnnngnnnngnnnnnananaaaan

Library Name / Clone Name np / np28565_0807
Strand Minus
Insertion Point 1881512
Chromosome Band X
Flanking Sequence
cacncngtggggnaaaaacncccnntnttgggggnnnggaaaaccccggctgtcgacggg
accaccttatgttaGGGCATCATGCCCTAGCGTTTCTGCATCCCTGGAAACTTTGCAGCT
ACANATGTATNNATGTGNGTATGTCTGNNNGNNAANACAAANGNNCAAGGAAGATNACAC
GTCNGGTGAAAAGGCGAAAGAGGGAAACAACCAACNAAGCNTTTTTTTTTGTGAGAGAGA
GAGAGAAAGCAAAAGCACTTNNNTGGCCNAAAAATAATACGGCGGCTGCAAANGAAAAGA
GCGCCGGGAAAAACCAGCCGCGCCAANNCGCCNTTCCTNATCGGGAGGACGAACACTTGG
GGGCCCNCAGCCGACGNNGGCCGNGGGAGGGGGGGGNAGAGCGNCGAAGNCCCGNGTTCC
ANCCCACGGCCCCCCCCCCACCAGANGGGTGCCNCGCCCCCCCCACCNCCGGCNCNGGGG
CCCNCNTGGAAAAACGGAAAGGGCCCAAGGANCGGCCCCCCNNGGGGGCCCTGCACCGGG
NCAANANGGGNAAAAAANNNGNNAAAAGGGGNANGNCNNGANNNGCCCNAATCNGGGNGN
NGGGNGAAACCCCCAANNNCCCAGCGCNGAAGGGNNCGCCNGGGGCGGGTNTNGCCCCCC
NAGCCGANCNGTNACCGTCNGGCNGNGGCNNCGNGGCGNAGCGGNNGNGCGNAAAAACCG
GCNTGGCCCCCCCCCCCCNNCCCCNCGGNGGGCTGCNACCGCGGGCCCGCCCCCCCCCGG
NTCCNNCGNACCNAANGGCCccncccnaannaaagacgngcggngcnccaccccccgccc
ggcnnacgccccnnggntgaanncnagncagcccncccanaaagaanggcccccacgggn
ncgcccccggggggggccccncngcncccncaagaangcnccgtcccncgtgnnaagcgg
gnggcgggggccccccacnnggaanaancccgcngccgcgnnaggcaccccnnatngncn
cgnngcngccnccgccgnacgcgnngggngcccccgcgcccncgcnaaaagngangcggg
cgngcgnccgccnngngccncgcggnggcagaagccgcgngggaganaaaaaananacaa
aaaaaaaaaaaan

Library Name / Clone Name np / np56953_0309
Flanking Sequence
ttttactcgcacttattgcaagcatacgttaagtggatgtctcttgccgacgggaccacc
ttatgttatttcatcatgCGCTAGGGATTTTATTGCCGAGAGGCGATCCTCTAGCTNGAG
CTTNGNCNACTNGNNAATTATTAAAANTAAAACTTNAANNATAATTTCTNCTAATTAATA
NNANNAGTTAATTNAAACCNNACGGNCATGCTAAAGNTTAATAAACAATNAAAACCCTNC
CTNNATNCTANGGGTTAATCAACNAAAANATCTATGCCTTACTCTAACACTNANTGNNAG
CANACGTAAAATNNATNTNNNTTGCACTCANTACCACCTTACNGTTANNTGANNATNCCC
TANNGANNGTANCGCCTNAAGGCAATCCATCATNCGCTANGNATNNTANTNNCGANAGGC
GATACTCCAGCTAGNGCTTTNNCCACTCNCAAATTATTNAANNTNCAACTNNAAAAATCA
NNNNCCNNNCATTAANGNNTANTAGNNAATTNTAAACCCCNNNNNCATTNNAANNNTTAN
NCANNCNNNTNANNNNNNNNNNNNNNANNNNANNNNNNNNNNNNNNNNNNANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE