Detailed Information [104569]
Strain Information
DGRC Number 104569
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NetA[NP4012] / FM7c
y* w* P{w+mW.hs=GawB}NetANP4012 / FM7c
Break points/Insertion Site 12F2
Map Viewer
Related Genes NetA CG5321 I-element{}129
Original Number 4012
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP4012

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 339
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression ventral epi, then lateral epi cluster (SG)
Larval GFP cns
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np28635_0807
Strand Plus
Insertion Point 14384817
Chromosome Band X
Flanking Sequence
antctttggggnaaaaaaccctttttttgtntacttcggtaagcttcggctatcgacggg
accaccttatgttatttcatcatgGTCGGGCTGCTTGTCCACAGGCGACTGTGTGTTCGT
TTTCGTTCGTCGCTCGTTTTTTCGGTTTTTCGGTTTCCCGCGAGGTGTCGTCTGCACGTG
CGTGTATGCGTGTGGGTGACTGTGTGTGTGTGTGAGTTTGTTNNTGACCCGCGCTTGAga
tcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgtttt
caggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagc
atccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaat
cgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcact
tattctatgctgtctcaatgttagaggcatatcagtctccactgagcatnttttttnttn
ggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnann

CLOSE