Detailed Information [104605]

Strain Information
DGRC Number 104605
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}slgA[NP4104] / FM7c
Genotype y* w* P{w+mW.hs=GawB}slgANP4104 / FM7c
Break points/Insertion Site 19F6
Map Viewer
Related Genes slgA CG32527
Original Number 4104
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP4104

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 498
General Information NP_lines
Embryonic Expression sg, psp (SG), a small # of cells
Larval GFP epi, internal
Larval X-gal epi
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np11965_0727
Flanking Sequence
acttcttngggngcannagnccctttttttttatacttcggtaagcttcggctatcgacg
ggaccaccttatnttatttcatcatgAACTCGCCCCATTTTCACGCGTCTTCGTCGCATT
TGGTTTCNTGCTTTTGCGGCGTATACAACGCTCAAAGCGTAATAGAATAAATAATAAGAA
CGAAGTAAGAAGAAAACCCAAAAGACACATAATAGCGAAAGATAGNTTTNTGCCCAGAAA
TTGACTTTTTTAATTGAACATTTCGAAGGTGTACTTGCGTACGTGTGATTGTGTTGTGCT
GTTTTTTTCGGCTTCGCTCTCCCTCGCCGCCTCACGTTTTTCGCATTTGTTGTATAACAT
TCGGAGCGAGCGAAAGAGGGAGAGCGAAAAGCTCTCCGACAAAATCAGCTGTgatcgaag
aatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaa
gggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccct
gggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatac
agtcaactgnctttgacctttggtactactctcttncgatgatgatgtcgcacttattct
atgctgtctcaatgttagaggcatatcagtctccactgagctnttttttttnggggnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnann

Library Name / Clone Name np / np30085_0807
Strand Plus
Insertion Point 21047809
Chromosome Band X
Flanking Sequence
cgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat
gttatttcatcatgAACTCGCCCCATTTTCACGCGTCTTCGTCGCATTTGGTTTCGTGCT
TTTGCGGCGTATACAACGCTCAAAGCGTAATAGAATAAATAATAAGAACGAAGTAAGAAG
AAAACCCAAAAGACACATAATAGCGAAAGATAGATTTCTGCCCAGAAATTGACTTTTTTA
ATTGAACATTTCGAAGGTGTACTTGCGTACGTGTGATTGTGTTGTGCTGTTTTTTTCGGC
TTCGCTCTCCCTCGCCGCCTCACGTTTTTCGCATTTGTTGNATAACATTCGGAGCGAGCG
AAAGAGGGAGAGCGAAAAGCTCTCCGACAAAATCAGCTGTgatcgaagaatacataagag
agaaccgtcgccaaagaacccattattggtggggtcccgtttcaggaagggcaagccatc
cgacatgtcatcctnttcagaccaatcaaatncatgaagagcattcctgggcatnaaatc
caacggaattggggagttatcatgatgagctgncgagtcaatcgatacagtcaactgnct
ttgacccttggtactactctcttccgatgatgatgtcgcacttattctatgctgtctcaa
tgttagaggcatatcagtctccngctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctn


CLOSE