Detailed Information [104620]
Strain Information
DGRC Number 104620
Genotype with FlyBase Link P{w[+mW.hs]=GawB}NP4149 w[*] / FM7c
Genotype P{w+mW.hs=GawB}NP4149 w* / FM7c
Break points/Insertion Site 2D3
Map Viewer
Related Genes ph-p EG:87B1.3
Original Number 4149
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP4149

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 60
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression epi weak stripe
Larval GFP cns, pns
Larval X-gal tr
Adult GFP antenna, wg margin, distal leg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2019-03-22
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np31065_0907
Flanking Sequence
TTCGTGNCTGAATTAANTGTATACTTCGGTAAGCTTCGGCTATCGACGGGNNNACCNCCA
AACCNNCCNTTTNTTTTTNNNNNTTTAAAAGGGGNTTTTNNNNNNNNTTTNNNNNNNNNN
NNNNNNNAAAAAAAAANNNNNNTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCC
CCCCCNNTNNNANTNNANAANAAAANNNNNNNNNNNNCCCCCCCCCCCCCNNNANATAAN
NATANAANAANNNNGGNGGGGNTTAACCGGGGTTTTTTCCTTTTTNGGGCCGGNCCCTTN
CCTTGGGGCCTTTNCCTTTTNCCTTTTNCCNTTTGGGGGCCCGGGNTTTTTTTTCCCCGG
TTTGGGGTTTTTTTGGGGGGGTTTTGGGNTTGGGGGGNTTTTGGGGTTTTCCCCCNGGNT
TNAAAAANTGGGGGTTTNGGGGTTTTCCCCGGGCCCCNNAATTTTAAAAACCCCCCCCCC
GGGGGGCCCNAAAANTTTTCCCGGGGGCCCAAAAAAANGGGGGGGGGNGGGGGGTTTTAN
ANAAATTTTTGGGGGGGGGGNAAAAAAAAAACCCCCNGGGGAAAAAAAAGGGGGGAAAAA
AAAAAAAAAAAAAAAAAACNCCCCCCCCNGGGGCCCCCCCCGGGAAAAAACNCNGCNCCC
CCGGGGAAAAAAANAAAAANTTTAAAAAANCCCNTNTTTTTNNAAAAAAAATTTTTGGGG
GGGGGGAAAAAAAAATAAAAAAACNCCCCCCCCCCCCCNTTNTGGGGGNCCNNAAAAAAA
AAAAAAANAATNNTTTTTTTtggggggggttttttnnaaaaaaaaaaaaaaaaaaaannn
nnttttttttttttnnntttttttccccccnaaaaaaaaaaaaaaaaaaaangggg

Library Name / Clone Name np / np62383_0309
Strand Plus
Insertion Point 1893628
Chromosome Band X
Flanking Sequence
tttacttcgcacttattgcaagtatacgttaagtggatgtctcttgccgacgggaccacc
ttatgttatttcatcatgAACCGTACACCGCCAAGTTAAGTTTCAAACTGAACCGCGCGC
CACAGCGACAACTCTACTTTTCGTTCGGATCCTCTAGCTAGAGCTTTGGNNACTNGNNAA
TTATGAAAAATANAACTTNAGANNATNATTTCGTCTAATTAATATTATGAGTTAATTCAA
ACCCCACGGACATGCTAAGGGTTAATNAACAATCATATCGCTGNGNCNNTGANANNNGNT
AGNCATGNTAANGNTNANTGANNNANNATATCGCTGNTNGNCTGCAAACNNAAAGNGANT
TTNTNTNNNTNTNANNNNCANCATNTGTTNTNNNATNATANACNNNNCNNNGNNTTNTTN
NNTNTANNNNNAANNNNANCNNNANAGNGANAANAATANNNNNNGNNNNGNTNNNNTTNN
NAAANNNNNNNNCNNTTNNTNNNNNNAAANNNTTNNNNTNTAGNTNNNNNNNNNNNNNNN
NNNNTNNNATNNNNNNNNANNANNNNNNNNNATNNNNNNNNNNNNNNNATTNNNNNNNNN
NNNNNNNNNNNNNNNTNTNNNNNNNNNNNNNANTNNNNANNNNNNNNNNNNNATNNANNN
NNNANNNNNNNTNNNNNNATNNNNNNNNNNNNNNNNNAATNATNNNNNNNNNNATTNNNN
ANNNNNNNNNNNNNNNATNNNNNNNNNNNNNNNNNNNNNNNANANTNATTTTNNNNNNNN
NNNATNTTATNATTNNNNNNntnnnnnnnnannnnaatnnnnntcnnnnnnnnnnanatn
nnnnntnnnnnnnnnntnnnnnnnntnnnnnnnannnannnntannnatntnnnnnnnnn
anctagnnnnnnnaanntnatnnnnananannnnnnnatnnnnnnanaannnaatnatn

Image Files
Larval GFP

g1 (->Large)

g2 (->Large)

CLOSE