Detailed Information [104636]

Strain Information
DGRC Number 104636
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}PRL-1[NP4223] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}PRL-1NP4223 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35F1
Map Viewer
Related Genes BG:DS07473.1 BG:DS07473.2 PRL-1
Original Number 4223
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP4223

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1206
General Information NP_lines
Lethality semi lethal
Embryonic Expression a small # of cells
Larval GFP pns
Larval X-gal trachea, gut, epi, mt
Adult GFP antenna, eye, haltare.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np12795_0727
Flanking Sequence
actntctgngggaaaaaaacccccnttttgggggcnnncgnaaanacccccggctatcga
cgggaccaccttntnttatttcatcatgGGCCGNACCGCCCGGCAGTAAGTCTCCATTGC
CGGGGAGAACGAAGAGAGAGTCGTGACGCACATCTCTCCAATCGCTCACGCAGAGAGCGA
AAAAAAATTATCTTACAGTCTGGTGCATATTNAAAGCGCTTNAAANTNTTTNTTGTGCAA
AAACAATAGAGGCNGGAAAAATAGAAACAATTTGCTTGGTTAGTTTTACTTTTCTACTGG
GGAACATAATTAGCAGAGTTCAATGGACCATGAAAGGGCGAATTTTGTGCTTACTAAAAA
TGTTTAAATTTTAAAGCATTTTATTCGTTCTGGTATAGTAGTGACAATATAAGTAGTTCT
GATTTAAAATCACGAGGGTATTTATTTTAAAANGTTAAATTGTTTAATTTTAGAAACTAG
ACAACAAGTTAGTTNGGATTCTGTTCTTTTTAAATATAgatcgaagaatacataagagag
aaccggcgccaaagaacccattattgntggggtccgtnttcaggaagggcaagccatccg
acatgncatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaaacca
acggaatnggggaggtancatgatgagctgccgagncaatcganacaggcaactggcttn
gacccttggtactacnctcttccgagganganggcgcacntattctanggctggcncaag
gnnagaggcatatcagnctccactgagcaaannnnnanggggnnnnnnnnnagannngnn
ngngnnnnngnnnagnannnnngngnnnnnnnngnggnngnggngngnnngngggnnnnn
nnnnnngggcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnana
gnagngaaaaa

Library Name / Clone Name np / np31455_0907
Strand Plus
Insertion Point 16229875
Chromosome Band 2L
Flanking Sequence
TTGGCGGNCCCCTNTGTTTTTATNTGGGCCGCTCCGTCCGGCAGTAGTCTCCATTGCCGG
GGAGAACGAAGAGAGAGTCGTGACGCACATCTCTCCAATCGCTCACGCAGAGAGCGAAAA
AAAATTATCTTACAGTCTGGTGCATATTTAAAGCGCTTTAAAAAGTCTGTTGTGCAAAAA
CAATAGAGGCAGGAAAAATAGAAACAATTTGCTTGGTTAGTTTTACTTTTCTACTGTNGA
ACATAATTAGCAGAGTTCAATGGACCATGAAAGGGCGAATTTTGTGCTTACTAAAAATGT
TTAAATTTTAAAGCATTTTATTCGTTCTGGTATAGNAGTGACANTATAAAGTAGTTCTGA
TTTAAAATCACGAGGGTATTTATTNTAAAATGTTAAATTGTTTAATTNTAGAAACTAGAC
AACAAGTTAGNTTGNGTTCCTGTNCCTTTTTAAATATAGATCGAAGANTNCATAAGAGAG
AACCGTCNCCCAAAGAACCCCTTTTTGNTTGGGGGTNCCGTTTTTCAGGAANGGCCAAGN
CCATNCCGACATTGTTNNTCCCTCTTNCAGACCAAATTCAAATCCCATTGAAAGAGCCTT
CCCCTGGGNCNNTNAAAANNCCACCGGNAATTTNGNGGGAGTTNTTCATTGAATGAGGCC
TGCCCNANGTTTAATCCCANACCAGGNNNAACNGGGGTTTTGGNCCTTTGGNGNCTCCCN
NTCCTNCCNNANGNNGAANGTGGGGNCNTTNATTCCTATGCCTGNCCTCAAANGNTGNAN
GCCNTTTTANGGTTTCNCTGgagncatnnntttttgngttntttttntttcttttctncn
ttccccccccnnctttnnncctnctttctnttntttccttnttacctgtntttncnttgg
tgttttntgnnttctgntntactcnttnntctcttttctttntccccnntncnctttcnc
cnttnttccnctcttctctnccncccttngcgtnttcctcncnncntcctnncntgccnt
tcgat

Image Files
Disc

d1 (->Large)


CLOSE