Detailed Information [104664]

Strain Information
DGRC Number 104664
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG7164[NP4300] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}CG7164NP4300 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 28C3
Map Viewer
Related Genes CG7154 CG7164 Uro
Original Number 4300
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP4300

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1091
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np13775_0727
Strand Minus
Insertion Point 7774699
Chromosome Band 2L
Flanking Sequence
acctantggggnaaaaaaccnncgctttttgggggcnnncgnaaannccccggctatcga
cgggaccaccttatgttatttcatcatgGGTCCGGGCCTTTCGTTTGCCACCCGAGCGGC
GATTGGTGGAGGTCACCATGTTTTGCGTCGGCTTCTGCAGGGCGGTCGACTTCCTGAGAC
TCGCCTTGTTGGCGGCACTGAATAGGGTGCGCGTCGAGTTGAGGTTTTTTAGCGAGGTGT
CCAGCTTGTTGCGAATCCTGTCCAgatcgaagaatacataagagagaaccgtcgccaaag
aacccattattgntggggtccgttntcaggaagggcaagccatccgacatgtcatcctct
tcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgnggag
ttatcatgatgagctgccgagtcaatcgatacagtcaactggctttgaccttnngnacta
ctctcttccgatgatgatggcgcacttatnctatgctgnctnaatggtagaggcatatca
gnctccactgaagccatcnnaaccngnannnnnnngnnnnnnnnnnnnnnannganncaa
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannn
nnnnnnnnnnannnnnnnnnnnnnannnnnnnnnnnngnnnnnnnnnnnnnnannnnnan
agnan

Image Files
Larval GFP

g1 (->Large)

g2 (->Large)

g3 (->Large)


CLOSE