Detailed Information [104669]
Strain Information
DGRC Number 104669
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG5270[NP4412] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG5270NP4412 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 86E7
Map Viewer
Related Genes CG5270 CG6728
Original Number 4412
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4412

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1438
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg, a small # of cells
Larval GFP sg
Larval X-gal sg, tr
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np13925_0727
Flanking Sequence
ctncctnnggngaaaaaaccccctattttttngacttcggaaagaccccggctatcgacg
ggaccaccttatgttatttcatcatgGCTTGGAGTCgatcgaagaatacataagagagaa
ccgtcgncaaagaacccattatnggtggggnccgnattcaggaagggcaagccatccgac
atgtcatnctcttcagaccaatcaaatccatgaagagcatccntntttttnaaatccaac
ggaattgtggagttatcatgatgagctgccgagtcaatcgatacagncaactgtctttga
ccttngttactactntcttccgatgatgatgncgcacttattctatgctgacncaatgnt
agaggcatatcagnctncactgaagccatcttatctgtncactgaagccaanatatnnat
gnnncgctnantntatgctgnactaangnnngaggcatatnanaccnccactgaanccaa
nnnannntgnnnnncannnnncnngnnnnnnnnnnnnnnanannnnnnnnnnncnnnnnn
nnnnnnnnnnnnnnncnnnnnngncnnnannnnnnnannnnnnncnnnnnnnnnnnnnnn
nanancnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np57143_0309
Strand Plus
Insertion Point 7247864
Chromosome Band 3R
Flanking Sequence
ttttactgcgcacttattgcaagcatacgttaagtggatgtctcttgccgacgggaccac
cttatgttatttcatcatgCTCCAAGCTCTGCGAGATAATATGTGGGCCTCCCTTATCAC
TCGCCAGTGGAAGCCGAAGCCTGAAGCCAGAACAGCTGCTAGTCGGTCAGCAGTGGAAAC
AAAAGGCGAGCTGTAACACAATAGATCCTCTNNCTNGNGCTTNGGCNACTNGNGNATTAT
GNATCCTNTANCTTGAGACTNTGATTTCTNCTAATTNATNTTATGAGTTAATTCAAACCC
NNCGGACATGCTTANGNTTANNNNACAATCANAACCCNGCGGANNTGCTAANGGTTANTC
NACCATCATGTCGNTGTCTTACTCTNNGCNCTAATTGNNGCCNACGNTNANTGNNTTTNA
NTTNNNNNNNNNNNCNNCNNNCNNNANNNNNNNNTNNNNNNNNNTNNNNNNNANNNNNNN
NNNNNNNNNNNTNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE