Detailed Information [104679]

Strain Information
DGRC Number 104679
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}desat1[NP4447] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w* P{w+mW.hs=GawB}desat1NP4447 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 87B10; -; 87B11
Map Viewer
Related Genes desat1 desat2
Original Number 4447
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4447

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1457
General Information NP_lines
Embryonic Expression scattered cells, posterior from A7?
Larval GFP fb
Larval X-gal fb, gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np69715_0810
Strand Plus
Insertion Point 8269770
Chromosome Band 3R
Flanking Sequence
attnttggncgtgaancnnanttttgngttacttncggtanccttcggctatcgacgggn
accaccttatgttatttcatcatgCTGCAGGTTCTTCGTCGTCGGCAATTTTTGCACATC
AGTTTTAAAACCCAAGTTAACCGAAACGGCTTGTTAATTTCTAGCTGCGGCGTATAAAAC
ACCTTTTTTTTTGGTAAAACAATAAACAGNGGTCTCAAATGAAATTCCATCGAACTTGCG
GCTGTTCACTTTTGCTGAACAGTTTGCAATTCTTGTTAATTTAACACTTTCTATGGCGTG
GGAGTGTGTGTGTGTGTGTATAACAAAGCATGCTAAAGTTGATTGAAGANGGAATTTTCC
ACGAAACGTGTCACAGCGTTCCTGGCTTCATTCGTAACCTTGAGCCANGGTTTCCATCTG
CTCCGGTTCCCAGNGACCCACAAAACACATGTTCCACATTAGGAAATCCACCTGGTGCTT
GTTCCCACACCGGCTTTTTACATTATGCATGCCATGCGAATCCTGACACANGGACGCGCA
AGCAGCGTTTATTGATTTTTTCATCCATTAGCCATTAGCCGATTAAAGCAACAGAAATCC
GTATTAGGCAAGAATATGCATATGTNCACAATATCAANGGGTACTCCACTCAACTCAACT
CAGCTCGACTGGACACCTTGGGGTCTGGCCATAAAGAGCCGCTCGGAGTCACCTAGCCAA
AGCGTGTCAAGGTTCAGTCATTCTGCTCACCTGGCTAATTGCCCAAGTCACCACCAAGTT
GGCACACACACTAATTGCTCtttggttaagggcggtactaaatnggngggttttatnttt
tttactcncncnccanttgatgcaanagcccgcccaacgcccaagcggng


CLOSE