Detailed Information [104688]
 

Strain Information
DGRC Number 104688
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Pak3[NP4472] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}Pak3NP4472 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 89C7
Map Viewer
Related Genes CG10405 CG14882 Pak3
Original Number 4472
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4472

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1519
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression restain
Larval X-gal sg, gut, cns
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np69795_0810
Strand Minus
Insertion Point 12278811
Chromosome Band 3R
Flanking Sequence
atntttgggcgtgcactgcanttttgtgtatacttncggtagncttcggctatcgacggg
naccaccttatgttatttcatcatgGGCTTGAGTAACAGTAACATTAACAATACCGAACG
CGAAACAACAACAAATCTGCCGAGCGTTTAGAATTTCCCAAGTCGAGCGTTACTAAACGC
ATTGAAGAAAATCCCCCCCACCCACACACACTCTTATATACATTTTCCGCTGGAAAATGA
GCTTCACCAAGTGGTTCAAGAAGAAGGGCGGAGATGGGGgatcgaagaatacataagaga
gaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatcc
gacatgtcatcctnttcagaccaatcaaatccatgaagagcatccctgggcataaaatcc
aacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagncaactgtctt
tgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaat
gttagaggcatatcagtctccactgagntcnnnnnnntnggggnnnnnnnntnnnnngnn
anctgnnnnatacnctngaccngggaccctnattntnntttnatttnttntnnnancnaa
agngnaannggggnnngnnaaacttnnattncctatnngnntnncanannngnnctnncn
nnnngnnngnccnaagnnnnnnnnncnnaannncncaggggnnnntnnnncgnnnnnntt
tttnnnaaaanntnnttnnnngnaannnncnttnnnnnnnnnnnnnnannnnnnnaannn
nnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnngnnnnnnngnnaanttttnntnn
nnngnnnaaaaannnnnnnn

CLOSE