Detailed Information [104692]
 

Strain Information
DGRC Number 104692
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG8336[NP4480] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG8336NP4480 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 67C2
Map Viewer
Related Genes Or67b CG8329 CG8336
Original Number 4480
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4480

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1846
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np31545_0907
Strand Plus
Insertion Point 9587715
Chromosome Band 3L
Flanking Sequence
ngtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat
gttatttcatcatgGTCACATCAGCCAAGGCCCGCCCCTAAGGGCAACAATGGAAGAACG
CAAGCTGCTCCGCGCGGTGAAATCAACTAATCCACTGGTCTACCTGGACATTTCCATTGG
CAAGGAGGATGGTGAGTGGAATCTGACCATTGCCATGCCAACCAACTAGTTGAATCTGTT
ACTCACACGTACATATATAATGTCACAGCGGGTCGAATGATAATTGAACTGCGCAAGGAT
GTTGTGCCGAAGACAGCGGAAAATTTCCGTGCCCTGTGCACGGGCGAATGTGGTATCGGT
ACTCTGGGCAAACCGCTCCACTACAAGGGCACAAAGTTCCACAAgatcgaagaatacata
agagagaaccgtcgccaaagaacccattattgttgggggtccgttttcaggaagggcaag
ccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatncctgggcata
aaatccaacggaattgtggagttatcatgatgagctgncgagtcaatcgatacagtcaac
tgtctttgaccctttggttactactctcttccgatgatgatgtcgcacttattctatgct
gtctcaatgttagaggcatatcagtctccnctnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnn

CLOSE