Detailed Information [104695]
 

Strain Information
DGRC Number 104695
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}dikar[NP4487] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}dikarNP4487 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 65C3
Map Viewer
Related Genes CG10107 CG32393 CG32394
Original Number 4487
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4487

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1795
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression mesodermal cells after stg 13
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np14545_0727
Strand Minus
Insertion Point 6701854
Chromosome Band 3L
Flanking Sequence
ancctttngggnnaaaaacccttttttgtatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgGTCCACCCACTCGACCCTTCCCACTCACATCCCCATC
CCCTGCGCTGCCCAGACCCTTGCGTGCATCGGAATGTTTGATAAGTGATAAAGCCAGATG
TTTGTGTATATATCGCCGCCAAGTGTCCCAACACACACACACATGTTGCACACATTTTTT
TTGTCTGAATTCTGCGCTCGCTCTTTTTGCCGCCTTTTGACTTTCGGTCGTGTTAATTTG
NAGCCTAATTCGTTAACGCCTGACCACATACGTTATATATACATATATATTTATATACCG
CAGCCCCGCCTTCCACACCAGANAGCCTACCAAAGAGGCCCAAGAATTGGTTCTTNCCTG
ACATTCTATAAAATCCCCGGANGAGGNNNCAACGNTTTCCAATAAAGNAANNAATACATA
AANGGGGTTCCNCTTTTCATTGGGAATNATTAGGGGAGGCAAANAAATTTACCCAAAACN
AGTTTCCTNCNTTAANAAAATCAATNTTATNGGGGAAAAAACCTAAACNACGGGNNCCCN
TATTTTTTATGGTTATTTNGATGGAAAATANCAACAAGGAGNTCGGNAGGTTACCCGAAA
AAATNGGTTAAAACAAATTGTTTTNTNTTTGNNNGAACNTTTAATATATGGGGGGGAGNA
ACCGGGGNNTTTTCCGNATTTNTGGGTNAATGGTNAAGNTCNNGGCTTTNGANNCGAAGA
AATACNAAAANAGAAGAACCgnnngcaaaagaacccntattnggggggggcccgntttta
gaggaggggnagagcctnccacanngttntccttttnngaccanataanatcnangaang
nncncnnggggataaaacnagggattggggagnttttanagagaggcggccggnaaaana
aannanaaanggtttgncctntnnnaccncctntttccgggagaaaggncnac

Library Name / Clone Name np / np31605_0907
Strand Minus
Insertion Point 6701854
Chromosome Band 3L
Flanking Sequence
ggngggnnnngnnnnaagggnnngnntgnngtnntgtntntttgggnnnnannanacggn
ngtcannaacnctcaatctcttnggnttncggtaagacttcggctatcgacgggnaccac
cttatgttntttcatcatgGTCCACCCACTCNACCCTTNCCACTCACATACCCATCCCCT
GCGCTGNCCAGACCCTNGCGTGCATCGGAANGTTTGATAAGNGATAAAGCCAGATGTTNG
NGTATATATCGCCGCCAAGNGNCCCAACACACACACACATGTTGCACACATTNTTTNTGT
CTGANNNGGGCGCTCGCTCTTTNNGCCGCCTTTTGACTTTCGGTCGNGTAATTNGAGCCT
AATTCGGTAACGCCTGACCACATACGTTATATATACATATATATTATANACGCAGCCCGA
CTTCCACACCAGAGAGCTACCAAAGAGGCCCAGGAATTGTTCTTACTGACATCTATAAAA
TCCCGCAGAGGAGCAACGTTGCCAATAAGCAAGCATACATAAATGGTTTCATTTTTAATT
GGATTATTAGGTGAGCAATAAATTTACCAAAACAGTTCCTACTTAACAAAATCAATATAA
TAGTGAAAAACCTAAAACACGGNTCCCTATTTTCTATTGGTTATATGGATGAAATATACA
ACAAGAGTCGCAAGGTACCGAAAAATTNGCTAAAACACATTGGTTTTCTCTTCGCAGACA
TTCAATCATGGGGGGGAGAACCCGGGTATTTCGCATTTTCTGGNCATTGGTNANNNCTGC
CTTGGATCGAAAAAACANAAgaaagaaccggnnccaaaaaaccattntggggggggcccn
tttnaggaagggaagccttccnaanggnatccttttaaaccatnaatncatgaaaagcnc
ccngggcataaaaccacggattggggngntttnaagaaggcngcggnnnaanngaacagn
naatggnttgaccttggaaccacccnntncnagagaggnnccctatttttgctgnnnaag
naaggcaaaanncngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE