Detailed Information [104698]
 

Strain Information
DGRC Number 104698
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Ptpmeg[NP4498] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}PtpmegNP4498 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 61C1
Map Viewer
Related Genes Ptpmeg mth
Original Number 4498
Chromosome 3
Comments FlyBase Insertion: FBti0036004
FBti0076729 insertion must be the same as NP4498 insertion.
NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1726
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns + pns (ch)
Larval GFP sg
Larval X-gal epi
Adult GFP base of ant S2, trochanter, internal head.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np14645_0727
Strand Minus
Insertion Point 328829
Chromosome Band 3L
Flanking Sequence
ancntttggtgcacngnccttatttgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgATTTGTGCTTTTTCTTTCTTCCATTCGTTAAACACTCCT
GTGATTGGGTCAATTGTATTCGTTGTTCTTTATGTCGACTAGATGGCCGAAGAAAGCGGA
GTATTGGTATTTACGGTTAATTGACGAATTTGTAAACAAATAATCAACGATTAAGTGCAG
TGCATCTTGGCTATCTTCCTTTCCCCTTCATTCCCCCTTATCTACGCTATTGCCACTTCC
TTCGTTGCACTACATGCGGCTTTCGAGATTTGTGTGCGTGTATGGATGGTTCTCTCTAAC
TCTATTACTCTCCCTTGTCCCGCCTGCGTGGAACTCCGGAAGAGGTAGAGAGCAAGAGGA
AGAATAACAATAATAATTACAAACACTGCAGCGAAAGAAGTTGCAGCACAAAGGGGAAAG
GCAGGAGAGGCGGGCTCTTCTTACCCTCTCTTTTTTTCTGGCTGNTGTACTATACTTGCA
CCAACNNAGATTTTGTATTTCAACAAATGCAGAATATTGTTTCTNACCGCATTNCGGAAA
AGANGAGCACACACCTGNATAGCCACCGGACTCACACCACTCGCACTTANGGCTGGCCGC
TTTTATTNGGACAACCAAAAGGTAGNAAAGAAAATTCACGCNGGGCCCGGNTTAACGAAT
CNGAAGAAATANCTTAAAGANGAGAACCCGTCGGCCAAAGAAACCCCATTATTGNTGGGG
GGNCCGTTTTCGAGGANNGGcaagcccatccccacttnttatncctcttcagaaccanca
aaatccangaagaagcattcctgggcatnaaatccaacgggattgggggagttttcatgn
nngagctggccgggtcnatcnnaacaggncaactgggnttganctttgttactactcttt
ttccgaggangangncggcctttattnttggcggnctcaagntaaggcnn

Library Name / Clone Name np / np31715_0907
Strand Minus
Insertion Point 328829
Chromosome Band 3L
Flanking Sequence
nnnttttcngcactgaanttaagtttatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgATTTGTGCTTTTTCTTTCTTCCTTCGTTAAACACTCCTGT
GATTGGGTCAATTGTATTCGTTGTTCTTTATGTCGACTAGATGGCCGAAGAAAGCGGAGT
ATTGGTATTTACGGTTAATTGACGAATTTGTAAACAAATAATCAACGATTAAGTGCAGTG
CATCTTGGCTATCTTCCTTTCCCCTTCATTCCCCCTTATCTACGCTATTGCCACTTCCTT
CGTTGCACTACATGCGGCTTTCGAGATTTGTGTGCGTGTATGGATGGTTCTCTCTAACTC
TATTACTCTCCCTTGTCCGCCTGCGTGGAACTCCGGAAGAGGTAGAGAGCAAGAGGAAGA
ATAACAATAATAATTACAAACACTGCAGCGAAAGAAGTTGCAGCACAAAGGGAAAGGCAG
AGAGGCGGGCTCTTCTTACCTCTCTTTTTTCTGGCTGCTGNACTATACTTGCACCAACTA
GATTTTGTATTCAACAAATGCAGAATATGTTTCTAACGCATTCNGNAAGAGAGCACACAC
TGNATAGCCACCGGACTCACACACTCGCACTCAGGCTGGCGGTTTATAGGACACCAAAAG
TNGAAAGAAATTCACGCAGGCCGGTTACCGATCGAAGAATCCATAAGAAAGAACCCNCGC
CAANAACCCNTATTGGTGGGGTCCGTTTTCAGGAAGGCAAGCCATCCCAAATGTTATTCT
TTTAAACCAACAATCCATGAagagcttcctgggcatnaaancacggaatggggnggtnta
tgatgagctgccgngnatcgancagnnactggcttggnccttgtacactctnttcgaaga
agaggcncnctatttatgcngcnaagtaaagnataacncngnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnn

CLOSE