Detailed Information [104724]

Strain Information
DGRC Number 104724
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Trim9[NP4638] / CyO
Genotype w*; P{w+mW.hs=GawB}Trim9NP4638 / CyO
Break points/Insertion Site 31F5
Map Viewer
Related Genes CG18302 CG31721 CG6138
Original Number 4638
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP4638

NP line. Received from the National Institute of Genetics.

Balancer CyO; TM3 Sb Ser
Cluster id 1152
General Information NP_lines
Embryonic Expression scattered cells
Larval GFP weak
Larval X-gal mg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np15025_0727
Strand Plus
Insertion Point 10537661
Chromosome Band 2L
Flanking Sequence
atntttacgtgcactgnanttaattgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGTGTAAAGTGAATAATTCGAGGATTACCAAAGACATGTT
GTCCCAAAGAGTGCAACCCAACTAAAGCGAGGATAAAACCGATTTAAACAGGACCTCTGA
CCTCGCCAACTCAATCCGAATCGCATTGCTCTTGCGGATTATAACCACCAGACATGGAGG
ACGAACTGCGCTGTCCCACGTGCAAGCAGCTGTACGCCAATCCGGTGCTGCTGCCATGTT
TCCACGCCCTCTGCCTGGGCTGTGCCCTGGACATCCAGACGCCGTACAGTCCGGgatcga
agaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcagg
aagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatcc
ctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgat
acagncaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttatt
ctatgctgtctcaatgttagaggcatatcagtctcactngnttnnnnntnntnnnngnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnn

Library Name / Clone Name np / np29745_0807
Strand Plus
Insertion Point 10537661
Chromosome Band 2L
Flanking Sequence
tttttngggtgcactgcatttatntgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGTGTAAAGTGAATAATTCGAGGATTACCAAAGACATGTT
GTCCCAAAGAGTGCAACCCAACTAAAGCGAGGATAAAACCGATTTAAACAGGACCTCTGA
CCTCGCCAACTCAATCCGAATCGCATTGCTCTTGCGGATTATAACCACCAGACATGGAGG
ACGAACTGCGCTGTCCCACGTGCAAGCAGCTGTACGCCAATCCGGTGCTGCTGCCATGTT
TCCACGCCCTCTGCCTGGGCTGTGCCCTGGACATCCAGACGCCGTACAGTCCGGgatcga
agaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcagg
aagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatcc
ctgggcataaaatccaacgggaattgnggagttatcatgatgagctgccgagtcaatcga
tacagtcaactgtctttgacctttggtactactctcttccgatgatgatgtcgcacttat
tctatgctgtctcaatgttagaggcatatcagtctccngctnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnn


CLOSE