Detailed Information [104739]

Strain Information
DGRC Number 104739
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Hsp70Aa[NP4683] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}Hsp70AaNP4683 / TM3, Sb1 Ser1
Break points/Insertion Site 87A2
Map Viewer
Related Genes CG31211 Hsp70Aa S-element{}1293
Original Number 4683
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4683

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1450
General Information NP_lines
Lethality semi lethal
Embryonic Expression muscle
Larval GFP cns
Larval X-gal epi. tr
Adult GFP ubiquitous (internal?)
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np32165_0907
Strand Plus
Insertion Point 7782315
Chromosome Band 3R
Flanking Sequence
atntttagacgtgcactgaatttangtgtatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgCTNCGNGGCTCTTTNCNCGAACATTCNAGGCNCGCTC
TCTCGAAGCACCNAGAATAGNGTGCCGTTTACTGTGCGACAGAGTGAGAGAGCAATAGTA
CAGAGAGGGAGAGTCACAAAACGAATAGAGAATANCGGGGGGCCGGTCTAGAACTAGTGG
ATCGAANAATACATAAGAGAGAACCGCCGCCCANGAACCCATTATTGCNGGGGTCCGTTT
TCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCANACCAATCAAATCCATGAAGAG
CATNCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATNATGATGAGCTGCCGAGTCAA
TCGATACAGNCAACTGTCTTTGACCTTTGNTACTACTCTCTTCCGATGATGATGTCGCAC
TTATTCTATGCTGTCTCAATGNTAGAGGCATATCAGTCTCCACTGAAGCCATCNNNNTNT
NGGGNNNGNNNTNNNNCCNTNNGANACTACTCTCTTNNCNANGATGATGNCACTCTTTTT
TNTNTGCTGTCNNANTGNGAGAGGCATATNNNNNCNNCANTGAACCNTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE