Detailed Information [104741]

Strain Information
DGRC Number 104741
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP4686 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP4686 / TM3, Sb1 Ser1
Break points/Insertion Site 66D10
Map Viewer
Related Genes CG6486 h
Original Number 4686
Chromosome 3
Comments No Sb expression, but Ser seems to be OK (not perfect though). 06Nov2012MT
FlyBase Insertion: P{GawB}NP4686

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:66D
Balancer TM3 Sb Ser
Cluster id 1830
General Information NP_lines
Lethality semi lethal
Embryonic Expression pair-rule type stripe
Larval GFP muscle, fb, others
Larval X-gal dorsal domain of leg/antenna disc, epi, gut, mt
Adult GFP muscle
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np15235_0727
Strand Minus
Insertion Point 8634375
Chromosome Band 3L
Flanking Sequence
cgtgcactgnanttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat
gttatttcatcatgCCTAGGGGTATACATTATGCGCTACCTGCTCGCTTCAGTGTGTGCG
TGTGTGTGTGCGTGCTCGCGCTTGTGAGCGGTACCTAAAGTACACACCGCGTTACTCATA
CGCCCCCGTGGCTCGCGGGAATGGGCATTTCTTCCTTTTTGGAAATCACACTGCGAAACC
CCCATTGGTgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttg
gggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaat
ccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagct
gccgagtcaatcgatacagtcaactgnctttgacctttggtactactctcttccgatgat
gatgtcgcacttattctatgctgtctcaatgntagaggcatatcagtctccactgagcat
ctnttnntggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np32185_0907
Strand Minus
Insertion Point 8634375
Chromosome Band 3L
Flanking Sequence
gtcaaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgCCTAGGGGTATACATTATGCGCTACCTGCTCGCTTCAGTG
TGTGCGTGTGTGTGTGCGTGCTCGCGCTTGTGAGCGGTACCTAAAGTACACACCGCGTTA
CTCATACGCCCCCGTGGCTCGCGGGAATGGGCATTTCTTCCTTTTTGGAAATCACACTGC
GAAACCCCCATTGGTgatcgaagaatacataagagagaaccgtcgccaaagaacccatta
ttgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaa
tcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatga
tgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttcc
gatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccact
gagcatnnnnntnnnnngggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)


CLOSE