Detailed Information [104747]

Strain Information
DGRC Number 104747
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP4698 / CyO
Genotype w*; P{w+mW.hs=GawB}NP4698 / CyO
Break points/Insertion Site 21F3
Map Viewer
Related Genes CG5397 robo3
Original Number 4698
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP4698

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 989
General Information NP_lines
Embryonic Expression pns (ch, TU)
Larval GFP cns, pns specific. not sg.
Larval X-gal central dot of leg,
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np32295_0907
Strand Plus
Insertion Point 1257531
Chromosome Band 2L
Flanking Sequence
anttctttngggggaaaaaacccncttttttnggtatacttcggtaagcttcggctatcg
acgggaccactttatgttatttcatcatgATTCGGCCAGTGCGCAGACTCACCACTTTCG
CCGGCAGGATTCAGCAACAAATGTTTATGCTCGCAACTGTGATGATAAACAAACCTGGCT
GAGACCAGAAACTACAATGTTGAGAAGCCATTTCAATATTATTTATTTGTTTTTGTATAT
TTTAAAAACCCTATTGATATATGATAAACACCAAACTTTCCATTAGAAGGGCTGCCATTT
TGTTATAACATTTACTATAATAGTACGATTGTACTTTACAGAAACACATAGCATTACAAA
CATTACAGAAAGCCTCTTATATGATGGTACTTCCTTATCAACAATTCGATTCGATTACTT
TTCGTTTTCCCGAGCTTTCCCCGCTGAAACAGCTGATTTGCCTGCAGGAATTTACTCCGA
AATGTTGCTCTTCCGACTTCCCCAGTTCCCCGAGTTCCGAACTGGCCGAGCTGCTCCGAA
GGCCGGAACTCACCACCCAGCGAACATTGCTGTGGACTGTTCCCGGTCTCCGgatcgaag
aatacataagagagaaccgtcgccaaagaacccattattggtggggtccgttttcaggaa
nggcaagccatccgacatgtcatnctnttcagaccaatcaaatncatgaagagcatncct
gggcatnaaatccaacggaattggggagttatcatgatgagctggccgagtcaatcgata
cagtcaactgnctttgaccnttggtactactctcttccgatgatgatgncgcactttatt
ctatgctgnctcaatggtagaggctatcagcncncnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE