Detailed Information [104760]

Strain Information
DGRC Number 104760
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG7145[NP4725] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}CG7145NP4725 / TM3, Sb1 Ser1
Break points/Insertion Site 78F4
Map Viewer
Related Genes CG14563 CG7145
Original Number 4725
Chromosome 3
Comments No or little Sb expression. 29July2016 T.O.
FlyBase Insertion: P{GawB}NP4725

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:79A5
Balancer TM3 Sb Ser
Cluster id 2025
General Information NP_lines
Embryonic Expression pns small subset (TU)
Larval GFP cns
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np15395_0727
Strand Plus
Insertion Point 21758594
Chromosome Band 3L
Flanking Sequence
ntcttttggggtgnaaaancctttttttgggtactnnggtaagcttcggctatcgacggg
naccaccttatgttatttcatcatgGGTNGGGNGGGNCGAATTTGGACTNGGCTAACGGC
CGGGAACTATCGGCAGACCGATACAATTTTGCCCCCCTTACTATCGTGCACCTTACAACA
CTGTCCATAGCTATCGATAAGGCGCCAAGAATGCACATGNTATNCNAAGAAATACATAAA
GAGAGAACCGGGGGGNGGGGNACCCATTATTGTTGGGGTCCGTTTTNAGGAAGGGCAAGC
CATNCNACATGTCATCCTTTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAA
AATNCAACGGAATTGTGGAGTTATCATGATGAGGCTGCCCGAGTCAATCGATACAGACAA
CTGTCCTTTGACCTTTGNTACCACTCTCTTCCCGATGATGATGTCGCACTTATTTCTNTG
CTGACTTAATGTTAGAGGGCATATNAGTCTCCACTGAGCATTTTNATTNNNGGGGGGNNN
NNNNNNNTNNNNNNNNANNNNNNNNNNNNTNNNNNANNNNNNNGNNNNNNANNGNNNGNN
NNNNNNNNNGNNNNNNNNNNTGNNNNNANNNNNNNNNNNNNNNNNNNNGNNNNNNGGNNN
NNGNNNGNNNNNGNNGNNNNGNNNNGNNNNNNNNNNNNNGNNNNNNAGNNNNTNNNNNNN
NNNNNNGNNNNNGGNNNNNNNNNNGNNNNNNGNNNNNNNGNNNGNNNNNNGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnngnnnnnngnnnnnnnnnnngnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnggnnnngnnnnnnnnnnnnngnnnnnngnnnnggnnnnnnnnnnnn
gnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnng
nnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnngnngnnnnnan

Library Name / Clone Name np / np32505_0907
Strand Plus
Insertion Point 21758595
Chromosome Band 3L
Flanking Sequence
atttttggnnnnnnctgcnatttatgtgtatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgGGTCGGTCGGTCGAATTTGGACTTGGCTAACGGCCGG
GAACTATCGGCAGACCGATACAATTTTGCCCCCCTTACTATCGTGCACCTTACAACACTG
TCCATAGCTATCGATAAGGCGCCAAGAATGCACATGgatcgaagaatacataagagagaa
ccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgac
atgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaac
ggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttga
cctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgtt
agaggcatatcagtctccactgagcatctttttttttnggggggnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE