Detailed Information [104776]
 

Strain Information
DGRC Number 104776
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP4777 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP4777 / TM3, Sb1 Ser1
Break points/Insertion Site 75F4
Map Viewer
Related Genes nkd Acp76A
Original Number 4777
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4777

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:76A
Balancer CyO; TM3 Sb Ser
Cluster id 1983
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression proximal leg, stripe in epi,
Larval GFP wg and leg discs. cns, lateral epi. tr pit.
Larval X-gal wg like,
Adult GFP proboscis
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2019-07-31
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np14115_0727
Strand Minus
Insertion Point 18994359
Chromosome Band 3L
Flanking Sequence
gngcctgatttagtgtatacttcggtaagcttcggctatcgacgggaccaccttatgtta
tttcatcatgGGGCAATGTTTCGATTCTCGAACGACTCGCATTCAGATTGTTTTCGTCCG
TTGATTCGAAAAGACGTGTGAACTGAGACTCGGAGATACAGCGGAAAGgatcgaagaata
cataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggc
aagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggc
ataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtc
aactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgc
tgtctcaatgttagaggcatatcagtctccactgagctctttttttttgggggnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)

d5 (->Large)

CLOSE