Detailed Information [104789]
 

Strain Information
DGRC Number 104789
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP4800 / TM3, Sb[1] Ser[1]
w*; P{w+mW.hs=GawB}NP4800 / TM3, Sb1 Ser1
Break points/Insertion Site 75E1
Map Viewer
Related Genes CG14073 ftz-f1
Original Number 4800
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4800

NP line. Received from the National Institute of Genetics.

Balancer CyO; TM3 Sb Ser
Cluster id 1977
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg
Larval GFP pns, gut
Larval X-gal sg, gut, tr
Adult GFP ubiquitous
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np29285_0807
Strand Minus
Insertion Point 18750213
Chromosome Band 3L
Flanking Sequence
anttttggcgtgcactgaatttangtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgCTTCTACCTACGCCAACAAACTTTTACTGTGTGTTGTG
TTCCCGTTCGAGTTCGACCTAATTTCGCTCGAGACCTAATTTTTGCGTGCGGAATAGTTT
TTCCCGAAAAAGTGAAGCCAGCGAATAAACAATAGCTGAAAGTGAGCGATAGCCAAGAAA
GTGAGAGTGAAAGTAAACAAAAGCGAAAAGAAGAACAGCTCTGGCGTTAATTATGTGTGT
GTACATACGTATATATTTAATATTTCCGATGCGTCCATAACGGGAGTGTGTTCTGGTTTC
CAATCGTCGCCCGCGCCCCCGTCATTGCCTATCCGTTTACCAAACCCTAATTTTGGTGTG
CAATTGTGTATAAAAATTAACACAAAGTGGGAAGATAGCGTTGTGTCATAGAATTGGAGC
AGAAGCAAAAAACAAGGCAAAATTAGCAAAAGCCAAGCGGAAAAACAACAACACAGAGTG
CCCCAGTGGAACCCCAGTACATGTGGTGTATATATGTATGTGCGGTGCGAGCGTNTCAAT
GTGTGCGTAGCANGAATTGCAATTATAGTTGGTGNTTTCTGAGAGCTTTCGGCTTGTTGG
GCGCGTGCGACGATTGNGCAAGAAGGTTCTTTGGNGGGNGGTTCCGAAAATCNGGGAAGA
AGGAAATCGCCNGAAAATTGGNGGGAGNGTTAATGGNCANTAAATGCCNAATTNATTTAA
NGGAATTNATTAAAAAAATTttnnttaanttgnccaaaggcgtttgggggtcnngngggg
gggcccgttttttggaaatttgctgnaaaaacntttngggggggcggggnccaaanaaaa
cnnnnncctnnnngngangcnatcganaaaanatnaaaaaaaaccgnncnccaanaaacc
ttnttgggggggnccn

CLOSE