Detailed Information [104800]
 

Strain Information
DGRC Number 104800
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP5004 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP5004 / FM7c
Break points/Insertion Site 19F1
Map Viewer
Related Genes CG32511 Rt1c{}197 mariner2{}198
Original Number 5004
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP5004

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 492
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression very weak
Larval GFP sg only
Larval X-gal sh. ventral nerve cord, not in disc. dots (PNS?) in discs. (s.g.)
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np43025_0912
Strand Plus
Insertion Point 20827066
Chromosome Band X
Flanking Sequence
tnaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgCACTAGCCCCTCTTGAACAGGACCACTAGCGCTCCGCTATGA
CATCAACTAACTGGAATGGCGCTCATTTTAAAAAAGGAAGTTTTCACGCTCTCAATTTTA
CGCAAGCGGAGAGAGAGAGAGAGCAATTTTGGCTGCCACCAGAAAAGAGGCTGCATAGAG
CAAAAAAACAAAGTTTGGCCGTTAATCATCTTGTTATTCTAGTGGTCTTTGGTCCCACAG
TATTATACTTAACATATTAGAAACGTAGCANTGGAGTTATTAGCATAAGTATAACAATTA
AAAAGCCTTAAAGTGTTGTGTTATGCACTTGTACAAAGTTTGCAAATCAAAGCGTGAAAT
AAGGCAGGCCCGATTAGTTGACCTCAGAAATCAATGTCTGTGTTTTGGCGCTATTATTTT
ACTATAGCGCGATTGATTTTACAAAGTTCTCAAATATTTTATTGGTTGGCTTTTCAGCAA
AAAAAAAGCGCAAACTATATGAAGAAAGGAGGTGTAGACAGTAACAACAATGGCGATGAC
GAAAAAAGTGAAAACGAAATTGAGACCGGCTGGGCCTAATCCCGAAATGGCAAGACCAAG
CTTATCGGGAAGATTTAGCCCAGGCTGATTGCAATGAAAACGATATTGGCCCGNTATGGN
GGACNCTCATNTCGCTTATCCTATGAAAAAAAGACCGAACTGCTCAAAAAATGCTGGACN
CCGCCCTAATTNAACTTGNTtattcgntagncacttgactgacnnnnttngttcgaagca
taatttaacantttccgatcnaanatacatananaaaacccccccaanaacccttnttgg
ggggggccccttttaggaaggcaaccctnccnatnttttcttttaaacanaaaacannan
aannnccgggnnaaacnn

CLOSE