Detailed Information [104810]

Strain Information
DGRC Number 104810
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}Mgstl[NP5025] / FM7c
Genotype y* w* P{w+mW.hs=GawB}MgstlNP5025 / FM7c
Break points/Insertion Site 19E7
Map Viewer
Related Genes CG15449 Mgstl
Original Number 5025
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP5025

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 485
General Information NP_lines
Embryonic Expression weak
Larval GFP sg only
Larval X-gal sh. not in disc.
Adult GFP Dll-like. tarsas, tibia/tr joint. ant, labial palp, probosis. wing margin, veis. Also internal.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np43175_0912
Strand Plus
Insertion Point 20715400
Chromosome Band X
Flanking Sequence
attttttgcgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgCTCCGCCCCGAAATTCGCCTATTCGCTTACGCCGCAAA
GAGAGCTTTTATTTGCCGGTATAAAAAAAAAAGCACACGCGAGTNTCGNTCATTTTATNT
TTNAGCGACGGCCGAGCAAGTTGTTGAATCCCAGACCAGACATTTTACGTNCTATAAAGA
TAATAAAGTTNTAGTTAAAACACATACAATGGCCAGCCCCGNGGAACTGCTAAGCCTCTC
CAATCCCGTNTTNAANAGTTTNACCTTTTGGGTCGGAGTTTTGGNgatcgaagaatacat
aagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaag
ccatccgacatgtcatcctnttcagaccaatcaaatccatgaagagcatccctgggcata
aaatccaacggaattgnggggttatcatgatgagctgccgagtcaatcgatacagncaac
tggctttgaccctttggtactactctcttccgatgatgatgtcgcacttattctatgctg
tctcaatgttagaggcatatcagtctccnctcnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np50785_0912
Strand Plus
Insertion Point 20715399
Chromosome Band X
Flanking Sequence
ggnggnnnngnnnnggnnngnnnngnnnngtntttnnnnngnnttttnaangtgncactg
natttantgtttacttcggtcaggcttcggctatcgacgggaccaccttatgttatttca
tcatgCTGCCGCCCCGAAATTCGCCTATTCGCTTACGCCGCAAAGAGAGCTTTTATTTGC
CGGTATAAAAAAAAAAGCNCACNCGAGTNTCGNTCATTTTATNTTTNAGCGACGGCCGAG
CAAGTTGTTGAATCCCANACCAGACATTTTACGTACTATAAAGATAATAAAGTTNTAGTT
AAAACACATNCAANGGCCAGCCCCGNGGAACTGCTAAGCCTNTCCAATCCCGTCTTNAAN
AGTTTCACCTTTNGGGTCGGAGTTTTGGNGATCGAAGAATNCATAAGAGAGANCCGTCGC
CAAANAACCCATTNTTGTTGGGGTCCGTTTTNAGGAAGGGCAAGCCATCCNACATGTCAT
CCTNTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATNG
GGGAGTTATCATGATGAGCTGCCGAGNCAATCGATACAGTCAACTGTCTTTGACCTTTGT
TACTACTCTCTTCCGATGATGATGTCGCACTTATTNTATGCTGTCTNAATGTTAGAGGCA
TATCAGTCTCCCTNGNTNNNNNNNNNNNGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNTNNNNNA
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnntnnnnnnnnnnnnnggnnnnnnnnnnnnn
nnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
n

Image Files
Embryo

e1 (->Large)

e2 (->Large)
Adult

a1 (->Large)

a2 (->Large)

a3 (->Large)

a4 (->Large)


CLOSE