Detailed Information [104827]
 

Strain Information
DGRC Number 104827
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP5053 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP5053 / FM7c
Break points/Insertion Site 18D11
Map Viewer
Related Genes CG12237 CG14213 CG14214
Original Number 5053
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP5053

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 458
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak
Larval GFP sh. sg only.
Larval X-gal sh. disc?. preffered to the ventral half of the eye disc.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np43455_0912
Flanking Sequence
TTTTGTTCAAACGTGACACTGNAATTTAAGTGTATACTTACGGTAAGNCTTCGGCCTATN
CGACGGGCACCACCTTTATGTTATTTCATNCATGATGCGAAGCAATACATAAGNAGNAGN
AACCGTCGCCAAAGNAACCCATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCC
GACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCC
AACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTT
TGACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAAT
GTTAGAGGCATATCAGTCTCCACTGAAGCCAATCTTATCTGTGGACGGGCNTTCTTTATT
TCACATTATCCTNGGTACAAAATNNTNCCCNNGTTNAACCAANTGCTTTTTTTAATATTC
CCTGGNNNAAGGAANTTCCCATTTTTTCCAAAAAATTCNATGGTTCNCNGGGGNCCTTTN
NTNCNGNGGGNNAAAAAATCCCANTTTTNNTANANTNNGCCTGGNNTTCCCCANGNNCCT
TTTTTCNTTGGCCCCTTTTGGGTTTTCCCNCNTNTNNTGGGTCCCGNCCTNNTNNCCCCN
TNAAGNCAAGNNGGGNGAAACCCTTTTTTNGNNTTTTGGGGGNAGGTAGTTNCCCCNANA
CNCCTTTCCCNANNTTTTTNTTNTTTTNAAAAAACACCTTTGGGGNTNCCCCCTTTTNCG
GGNNTTTTTTTTTTTTTGGGgaagccccccnttgngnncccttttnttnaaaagncccng
gnccanaatnatnggnccntngnccntgggncccaaaaaaaaaaaaaangggannnccn

Library Name / Clone Name np / np50865_0912
Flanking Sequence
tttangaggcttgcttaggtntgnttctgctatcgacgggaccancttatgttatttcat
catgATGCGAAGAATACATAANAGAGAGCCGTCGCCAAAGAACCCATTATTGTTGGGGTC
CGTTTTCAGGAAGGGCAAGCCATCCGACATGTNATCCTCTTCAGACCAATCAAATCCATG
AAGAGCATCCCTGGGCNTAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGA
GTCAATCGATACAGTCAACTGTCTTTGACCTTTGGTACTACTCTCTTGCGATGATGATGT
CGCACTTATTCTATGCTGNCTCAATGGTAGAGGCATATCAGNCTTCACTGAAGCCATGTT
TTNNTGGGGGGGGGNNTTTTTTTTTTNGGAANCCTNGNCCNNTNNNTNCCNGGCNNCTGG
GNNTTGAANNNTNGGGCNAACNNTNCTTNCNNAAAANNTNNGGNCCCCNNTTNTTTAGNN
GGNNCNNNNGGNNGGNGGAAACANNNNNTCCCCTTNAGNCATNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np65583_0309
Strand Plus
Insertion Point 19373676
Chromosome Band X
Flanking Sequence
GNNGGGGGGNGGGCCNGCCCGGGGGNGGGGGGNNGGTTTTGGCCCGGNTNTTTGGNNGNC
ANTTNCNGNCAGTCNGCGTTNANTGGANGTCTTCTTGCCGGCGGGNCCACCTTNAGTTAT
TTCATACATGGGCTGNGNGTGCNAACNACCCTAATANNNACCNCAAANNGCAAAAGAGCA
NGCCCGGACNAGGTCTGAGCTACACCTGGTAGTTCTAACTGGTNAAAGGCCNTGCTTAAA
TATAAATATAATGCACGGTAATATAATANGTTGTCTGGAAATATTATATTTGATTAAAAA
TGAAATAATATAACGCGCTCTATTAGTTCGATTAAATCTGTAGTTCTTTGTTTGAAATTC
ATCCAGTTACCTTACTTATGTAAAGATTGGTGTGAAGCATTAAAGCATTGTGAACTCACA
TTTTTTCAACTAGTTAACGATATAATATGGTTACTCCCCAACGAGTAAAAATAGTTAAGG
AATGTGAACAAAAATTCAACTTTGAATATAATAAAATTAGGCTACAAATTAGCTAACGTT
TGGAGCATTCCAAAGCTTTCATAGCATCCAGCTGCAAAANAGCCAAGCTGGCATNCCTGC
CACCACTGACAGCTCGGCCCCAGNGTAGCGNANCCCTGGCGTTTGACAGCCGACGNGGAG
CTGNNATNGGNAAACACATACGAANAACGGGGGNNTACGCGGNAGNCGACGANNGGANCT
CATTNAGNNGGAAANTCTGAAATAAAGCGNAGGNANGNGNGNNNGCNNAATNNGAANNTN
CAGNTGNGCTCGCNCAGNNNnnnaaaaaaaaaggnnnngaaggntatnangncacncnnc
anaggnnnatnngnccnggncccgnnntngncnnnggancnngnnnnnnnccgnnnnnnn
nccaaannnnnnnnnnnnnaaannaaannaannnnnnnnngnnccccncccccn

Library Name / Clone Name np / np68403_0309
Strand Plus
Insertion Point 19373794
Chromosome Band X
Flanking Sequence
ttnaagnttgnggcactaaanncgccagtnnttcggggagnaggaagtacccttgccgac
ggggaccaccttatgttTTTTGCAACATGGCTTGGAATGNGCAAAATACCGATNATATAC
CACAAAAATGCAATANTGCAAGTCNTGTCNNGANCTTATAATAATGTAATGATACTAACC
NGGAATTAGGTTTNGNATTNNATAAANAATATAATGTAGTNNANTANAAAATGTAGAATN
TNTTTTTTTNNATTANGGATAATNTATGAAGNAGANATAACNNCCCANATANTAAANNCG
ATNTAACATCTGGGAGAATATTTNNNNGNTAATTAAATANTATNNCNCCATTTTCTTTNT
ANNANANNATTTNTNTGTAANAACGATTTAGANGNAGNNGNAGAATNGCAANANNAGAAG
ANTAGGTTANGNGAAANAAGAAATAACNAGNGATATAATNGNNNTAGANTNGTGGNGAGG
TANTANAAAGGNNANANANNGANGCGNTGAANNANANAANGANNNANTAGCGANAANAGA
ANTANNGNNCGNGTNTNNNCGATTANTNGANGNNGNNANTNCCNCGNNNANGANAAAATT
NAANANNGAGNNNNGTGNTNAAGANCCCANNNGCAGTNGANAGANNAGNNAGANANNANA
NAATANGGANTAATTCGNNNAANNAAGNAANANGAAAGATTTTTTANATCACNNCTTANA
NNNTCCTNGGCANTTTTANTAGNANNTAGNNTGNNGAGAGCNAGNNCNGAATNAATCGCG
NGGCNCNNNTACNCCCTAACanannannnaaaaannananncnaagngagaannnctcag
antnntacccnnnannncctnncnnancgcncgagnncnnnncgagaggaannagnnacc
tgccggnggagcnnngagnacacactanannanncccccgccgnnatanncncngnntna
ccgccccacagnaangtttngttcangtttgangannatntncanccgcgannccccccc
nccgnngnaagcncgannaccg

Image Files
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)

CLOSE