Detailed Information [104837]
 

Strain Information
DGRC Number 104837
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP5072 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP5072 / FM7c
Original Number 5072
Chromosome 1
Comments NP line. Received from the National Institute of Genetics.
Balancer FM7c
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression uniform epidermal stain from stg 11. including trachea.
Larval GFP sh, strong general stain.
Larval X-gal sh. disc staining. wing: uniform. leg: strong in central (tarsus) and peripheral circles. (s.g.)
Adult GFP No remarkable signal in epidermis. y weak. ocelli
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np43645_0912
Flanking Sequence
GNNNNNGNNNNGGNGGGNNNNGNNNNAAGGGGNNNGGGNNTGGTTTTTNTTNNTCTTTGG
NNNGANNCGACCGNGNNGTGAANNANNNCCCANTNAAANTGGGNGACTTNCGGAAAAGCC
TTCGGCTATNCGACGGGNACCACCTTTTGTTATTTACATCATGTTCCTGTTGTTCTTCGC
AGCTAGTTCCAAAGAAATTACGTGCGTGTCTTTAATATTTATTTTTCGACGCCGCCTCTT
CTCTACACAACCCCCCCCCCTCCNTCCNTCCGTTNTTNAGTTTNTGATTCAGTGGTNGAN
AATCCGNATCCGAAAATTCGNAGNNGGGNNGANATATGNNCAAGGCTGTTCGCTGTTNAA
GGGGGGCTNAATTTTNGCNAANAAAGAGGCNCAGCANAANCNCCGATNGGNGGGCAANAA
NANACATGNGTANATNCAAANATNCNCGTCGNTNGGGNGGGGNAACCGGNTGGCCTGTTG
CTCCGNTGNCGCTGCAGGATCNAAGAATCCATANGAGAGAACCGNNGCCAAAGAACCCAT
TATNGNGGGGGNCCGTTTTCAGGAAGGGCAAGCCATCCGACATGNNATCCTNTTNANACC
AANCAAANCCATGAAGAGCNTCCCTGGGCATAAAANCCANCGGAATNGGGGAGNNATNAT
GANGAGCNGCCGNGNNAATNNANNCANNNAANNGNNTTNGACCTTNGNNACNNCNCNNTN
CCGNNGANGANGNNNNNCTTATTNTATGCTGNNNNAANGNAGAGGCATATANNCTCCCTN
GCNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
n

Library Name / Clone Name np / np65653_0309
Flanking Sequence
tttttgcntgcgcacttcntgcantcatgacgttaagtggatgtctcttgccgncgggaa
ccaccttatgttatttcatcatgTAGCAGGNAACATCAATGAAGTTNTACAGCATATACA
TATAAGCAACACACGAGANGGAGGAGTANGCCACACACACTACACACANACTACGACCAC
GTCGACGNTATCTTGTAGGCTACANGTCNTATGGCCTCAACGGGANGNTCGGCANTTTNA
GGCNGAGAAGNAAAAAAAAAACACCCNCTNGGTCCGANANAAGNNAAGANACCCANNTNN
NGGGGTGTTANANNCNTGCTTTCCCGAANTNTAAAAANAGANANACCCNTNTTTANGCAC
ATNNNAANAANNNCNCCNTGANNGANANTATTANGNCNTCTATANGAATANCAAGGNAAG
AAAACCTAAAGTNGCCNATNTCCCANTNTTTTTNGGNTNNNTNATATATTNGNNAANNNA
AAAAAAAANNNTNGGNNCCCNANNGGGGATNANCCNATNNTNNGGNTTANCAANANNNGG
TNATATTATTATTNTTNCATAANAAGNNGCGGGGGAGTTCAGAANGCGGGTNTNNNNTAN
GAAAGANNTCGTNATTNNATNCCAAGNGGGNNTANTTATTNNGNGGNAANATANNNTTGG
GGGGCCNCCCCCAGNATNATAAANNACNCNNCTATTGCAGNNATTATAAATCNNNGCNNA
GNGANCNCNCCNTTTNGNGNCNTTAANANACACAATAATNNCCGGANATAGANCNANCNT
NNGTGGNTTNTTCCCNTNGCncatgnnnangtnntnatngantttcggcaatngnngtng
gcttnngantnttgnnngngannntntnatgacngaaagnanatatnnacnntncnnncn
nngccncnnntttatntanatatgtncangnccccaggcnagntccatntacnnatanaa
nnnnnttnncccccttnntngtgntncanccnnannanaatcgcgnncnnngcgg

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)
Embryo

e1 (->Large)

e2 (->Large)

CLOSE