Detailed Information [104864]
Strain Information
DGRC Number 104864
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG9171[NP5131] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
y* w*; P{w+mW.hs=GawB}CG9171NP5131 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 25F5
Map Viewer
Related Genes CG14005 CG31913 CG9171
Original Number 5131
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5131

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1045
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression scattered cells
Larval GFP poor mating. No gfp larvae.
Larval X-gal not in the discs. (s.g.)
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np45295_0912
Strand Minus
Insertion Point 5792411
Chromosome Band 2L
Flanking Sequence
ttcgtgncactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacct
tatgttatttcatcatgCCACAGACTTTTTGTAGGCTTTTCCACTTTTTCGATTTCGAGA
CTTCGAGCGAAACGGTCGTGTTTTTCGCGTGTGTGCGGGGTGGCGGACGCGCGTGCCAAT
CGGAAAAGGCCTTTAAATCAAATGAGTGGGCTCGCCAAAGGAGCGCATCAAGGGTGTGTG
CGATTTGTATCGAGTGTGTGTGCTTTGTGCGGTGCGGGAGAAAGCCCAGCCCAGCCCGCC
AGTCTGGGGATAAAAAAAAAAGATTAAGATTGGGATAAAACAAACGAACGGGCAGCGAAG
TGCACAAATTGCCGTGGGATCGGGGCTNAAGAAAGGAAAACCAGTGTGCCAGCACCACAC
GGGTTGGAATGGTTGCCAATGTGTGCCGAGCCGTCANCCTTAATTAACCACCAAAAATTT
CGATTTGCAACAAAAAAGAGCGAGCCGAGTGAAAAANCGCCNAGAGTGGGAAGGCTTGTT
ATTGGTGGTGCTTGCTTGTTGCCCGCCGCTTGCTGNTGGCATGCCCCGAAATTCCCATTC
CCAATTAGGTTGAGCCCTTGCCGGGCCTTTTCCTTACTTAACCCCCGGAACCATTCCNCT
TTTTACACTGGTTGGTTGGCCAGGGNAAAGTTCTTCGGTCTGGTTTTGGGGGNCTNCTCC
GNTTTTNTTTTTTCCAGGGCCCCACANTTGGGCTACAAACTTTNTGNAAANCCCGTTTCG
GTACCNTTNGGNTTTGGCCCgcctaacccccccccccttnananattaannggggttttt
ttttttgtngggnggnacccccncttncaggnttttttttnccngntnggggnngnnggn
nttttttncccccccccctttttttttttaaaaacgggtnnnaaaanaaanttttngggg
gnncccgcccaccnacc

CLOSE