Detailed Information [104897]

Strain Information
DGRC Number 104897
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5203 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP5203 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 36D1
Map Viewer
Related Genes CadN CadN2
Original Number 5203
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5203

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1230
General Information NP_lines
Embryonic Expression muscle subset? (TU)
Larval GFP labial? sg. posterior spiracle.
Larval X-gal not in discs. (s.g.)
Adult GFP probosis
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np49035_0912
Strand Plus
Insertion Point 17756432
Chromosome Band 2L
Flanking Sequence
gtcaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgTTCAAATCGAACTGAAAAGCGAGGAATAAAAACAAATgatc
gaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttca
ggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcat
ccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcg
atacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcactta
ttctatgctgtctcaatgttagaggcatatcagtctccactnagctcttttttttngggg
ggnnngnnnnntttttnttnannattnnnnntngnncnaannaatnccnggnnaacnaat
gctttntatatnnctgnnaaagaatnccattntcaaaatnnatgnnnnngggncttntng
nggnaaaaatnannnnaaanngctgnnncannntttntagccttgnntncnnnttnngnn
nnnnnnnnccntannnnnnggnnnncntttnngntttnggnanannnnnnnnnctnncnn
nnnnnnttnanannctnngnnnnncttnnnnnnntnntttngnncncntnnnnnnttntt
aannnnnnnaannnnnnnnnnnntnnnnnnnnnnannnnnnnnnnnnnnnnntnnnnnnn
gnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnn

Image Files
Adult

a1 (->Large)


CLOSE