Detailed Information [104923]

Strain Information
DGRC Number 104923
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG33785[NP5256] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}CG33785NP5256 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 57A9; -; 57A8
Map Viewer
Related Genes CG11110 CG11132 CG33005
Original Number 5256
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5256

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 886
General Information NP_lines
Lethality lethal
Embryonic Expression weak epi stripe in stg 11.
Larval GFP sg only
Larval X-gal not in discs. (s.g.)
Adult GFP internal.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np49485_0912
Strand Minus
Insertion Point 15707461
Chromosome Band 2R
Flanking Sequence
gtaacgtgcctgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacct
tatgttatttcatcatgGCGCGGATTCGGATTCTCCGAAACTATGTTGTTTTTCTGCCCG
TCGTGCGGAAATATATTGATTATCGAGGAGGACACCAACTGCCATCGCTTCACGTGCAAC
ACCTGCCCGTACATATCGAAgatcgaagaatacataagagagaaccgtcgccaaagaacc
cattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcag
accaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagttat
catgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactct
cttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtct
ccactngctnnnnntnnnnggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)


CLOSE