Detailed Information [104953]

Strain Information
DGRC Number 104953
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG18549[NP5325] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG18549NP5325 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 87B11
Map Viewer
Related Genes CG18549 CG5509 CG5538
Original Number 5325
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5325

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1458
General Information NP_lines
Embryonic Expression all tracheal cells from stg 15. mosaic expression.
Larval GFP all epi, tr
Larval X-gal epi. tracheal attachment sites of the wing disc. (s.g.)
Adult GFP blood cells, internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np50065_0912
Flanking Sequence
TGATNAAGTGTNCTTCGGAAGCTTCGGCTTCGACGGGACCCCTTATGTTATTTATCATGA
ATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTC
ACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCG
GTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGC
CAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGC
CCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGA
CTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTTCTGTTCCGACC
CTGCCGCTTACCCGGATACCCTGTCCGGCTTTCTTCCTTTNGGAAGCGTGGGCGCTTTCT
CATAGCTCACGCTGGAGGTATCTCAGTTCGGGGNAGGTCGTTCGCTTCAAGCTGGGCTGG
GTGCACGAACCCCCCGGTCAGCCCGACCGNTGNGCCTTATCCGGNACTATCGGCTTGAGT
CCANCCCGGAAGACACGACTTATCGNCACTGGCAGCAGCCNCTGGTACAGGATTAGCAGA
GCGAGGTATGTAGGCGGGGCTACAGAGTTTTGAAGNGGGGGCCTACTCCGCNCNCCTTNN
ANAACAGNNTTTGGATTTTGCCTTTTGGTGAAGCCAGNTACCTTGGNAAAAAAATTGGGN
GCTTTTGATCGAAAAAACAAnaaaananaaccggcgccnaanacccattnttgttggggn
cccntttnaggaagggcagccatnccaaatgttattcttttt

Library Name / Clone Name np / np68133_0309
Strand Minus
Insertion Point 8275451
Chromosome Band 3R
Flanking Sequence
tnntttgggcgcnttanccgcagtnntacgttnagtggntgtctcttgccgacgggnacc
accttatgttatttcatcatgGTCTGGNAATGCCGTAAAGGACGAACATAAAGCCAAAGC
CCAGGCATGAGTATCATTAAGAATTTGAAATCCATCCTGCTGCTGCGCTATGTCTTTTCC
AATCACAATAGAACCGAATTAAATTAACTTGCCGCGCACTTTTGCATTTGCGTTTGCAGT
TGCCGACGTAACCAGAGAGGGGGAGATCCTCTAGCTAGAGCTTTGGCNANTAGTGGATTT
GGATACTNTANGTNGAGTTTNGNNGTTTTTNNNTNNATTNTTNNNTNGNNAGNNNNNNTN
GNNTTNTNTNTANNTTNNNNATANNTNNGNANNTAANNATNNNNNGGNNAGNGNAGNNTT
TGGTTGTNNTNNGNGNNTTANNNNGTNTGTTANTTNTGNNTNTTNTTNGTGNNNNNGAGN
GNGNTTTNNTTTTNNNTGNNGNTTNNTTNNTTTNANAGNNTNNNTTNATNGTTNNTNGCN
CNTTTTNGTTTTNAGNTANNGTNNANNTNNAGNNTTTTNTATNNNGTNNTNAGATTNTGN
NANANNNGGGTNNTNATNNATTNGNTTGNNTTANTNNGNNNNTNGNNTNTNNTTANTATT
TTNAGTNTTTTTATGTNGNTATNAGNAGNAANNTTTTNNGGNAGGNGGNCGATNGANAAN
TTATANNNNNGNANATATNANNNGNNTTTTGTTNNTGNTNNTNTTTTTNGGGTNNNTNGN
GNTANNAGGGGNNAANANNNtnnnngnnnntttctnanttttttatttttnannattnnn
nngtngnngagnagttttntaangggnnngtaagttcccgcgttntctagncnancgtag
tttntngattttnnntntngtngngnncgagngtgttcgancncgtnacnncnnccnccc
nccn

Image Files
Embryo

e1 (->Large)

e2 (->Large)


CLOSE