Detailed Information [104958]
 

Strain Information
DGRC Number 104958
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}ftz-f1[NP5333] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
y* w*; P{w+mW.hs=GawB}ftz-f1NP5333 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 75E1
Map Viewer
Related Genes ftz-f1 roo{}1043
Original Number 5333
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5333

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1975
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression weak
Larval GFP all epi, trachea
Larval X-gal epi. not in discs. (s.g.)
Adult GFP uniform, strong.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np50145_0912
Strand Minus
Insertion Point 18720675
Chromosome Band 3L
Flanking Sequence
AGNACGNGCACTGTAATNTAANTGNNTACTTNGGTNAGGCTTCGGNTATCGACGGGACCA
CCTTATGTGTATNTTATCATGATNCANGCCCCANAAGCCGAGAGCGCGAGAGCGGCCGNT
TGNGGGCGAAACTTGTTCGTGCTGCCGNTGTCGNCGNNGGCTGCGCTGCCGTCGTCGCAG
TCGATTATTTCATATTGAAAGCAAAAGTGATCGAAGANTACATANNAGAGAACCGTCGCC
AAANAACCCATTATTGNTGGGGTNCGTTTTCANGAAGGGCAANCCATCCGACATGTCATC
CTCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATNCAACGGAATTGT
GGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGACAACTGTCTTTGANCTTTGGT
ACTACTCTNTGGGCGATGATGATGNCCCACTTATTCTATGCTGNCTCAATGNTAGAGGCA
TATCATNCCTCCACTGAAGCATANNNNNNNNNNNGNGGGNNGNNNTTTTTTNTTNNNNNN
NNNNNNNNNNNNNNNNNNNNCNGGNNNNNNNGNNNTTNNANNNNNTNGGNNCNNNCTNTN
NNTNCNCNAAAAAAANNNNNNNNCCNNNNNTNTTNGNNNGGNNNCNANNGNNANAAAGNN
AAAANNNNNTNTNCNCTNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE