Detailed Information [104961]

Strain Information
DGRC Number 104961
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5336 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP5336 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 79A2
Map Viewer
Related Genes mub CR32449
Original Number 5336
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5336

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 2026
General Information NP_lines
Embryonic Expression CNS, patchy
Larval GFP weak epi stripe. CNS (s.g.).
Larval X-gal ch organ. center of the leg and antenna discs.posterior to MF in the eye disc.
Adult GFP strong in body. Not expressed in tarsas, haltare, max pulp, tip of genitalia.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np50165_0912
Strand Plus
Insertion Point 21796621
Chromosome Band 3L
Flanking Sequence
tgncaaacgtgcactgaatntaagtgtatacttnggtaaggcttcggctatcgacgggac
caccttatgttatttcatcatgCTCTCGAGTGAGCCAACTCTGNGGTCCACTCAACTCAA
TCAGTTTCTGGTGCGAGTGAGATGACCATAGTGGCGTGGGCGCCTTGAGTGGCTATCGTG
CTGCGGTGTGACCACGCGTGCGCAGAACGAAAATACCGCGGAAGCGCAAAAGTACCAGAA
TTTCCCTGGTATCGCGCTCTCTCTCTCCCGTTGAGCGCAAACACCCACCCCGAGCGCCGC
CTGCACCGTTGTTCATCAGTGTATCTGCTTCGCCCTGCTTGGGCTACTCATTCGGCGAAA
ATTAATGGTGGTGTTCGGTTCTACGTCGCGCAAGGCACAGTCTCTAGAGTCTCGCANAGC
TAAGAATACATCTCAGAAAATCGGCAACCAATATCCAAGTTCAGCCAAGTTTGCGGTGTG
TAGGCAAGCCATCGAAAAGTAACGACCGAAATAACGGCAGTTGTCGCATAGCAAATGCCA
ATTGCNAATTGCGAGTTGCAAACGCAAATCAAAGTGTGCGCAGGAGAATAAGAAACANAG
AAACGCANTTAACAAACGTGAAGTAACAATCCGGCAAAGCGAATAAACCCGATACCGATT
TCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgggggtcc
gttttcaaggagggcaagccattcnacatgtcattcttttcaaaccaatcaaatncatga
agagcctccctgggcataaaatcccacggnaatttnggagttatnatgatgaggtggcga
ggnaatcnanacagnccactgnctttggcctttggnactactnttttgcgggggangagg
gcgnncttattntntgctggctnaaggtaaagan

Image Files
Disc

d1 (->Large)

d2 (->Large)
Adult

a1 (->Large)

a2 (->Large)

a3 (->Large)


CLOSE