Detailed Information [104990]

Strain Information
DGRC Number 104990
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5399 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP5399 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 78A1
Map Viewer
Related Genes fng CG10586
Original Number 5399
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5399

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 2011
General Information NP_lines
Embryonic Expression muscle (mesoderom from st 11). psp
Larval GFP tr pit associated cells. tr hb in young larva. tr node.
Larval X-gal dorsal half of the wing and haltere discs (fng like pattern). multi-circles in the leg disc.
Adult GFP distal leg (tarsas) ventral thorax, hinge. not very indicative of disc expression. ubiquitous in yound adult.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Taniguchi K, Kokuryo A, Imano T, Minami R, Nakagoshi H, Adachi-Yamada T.
Isoform-specific functions of Mud/NuMA mediate binucleation of Drosophila male accessory gland cells.
BMC Dev. Biol. (2014) 14 46 [PubMed ID = 25527079] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np50745_0912
Strand Minus
Insertion Point 20867004
Chromosome Band 3L
Flanking Sequence
gngcactgaatttaagtgtatacttcggtaaggcttcggctatcgacgggaccaccttat
gttatttcatcatgGCACAAGCTAAAGAGAGAGGATGAGAGCGAGCGCgatcgaagaata
cataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggc
aagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggc
ataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtc
aactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgc
tgtctcaatgttagaggcatatcagtctccactgagccatcttntnnttgggnnnnnnnn
nnnnnannnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnntnnnnnnnaannnnnnnnnnnnnnnnnnnnnnnnnnnntannnnnttn
natnnnaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)
Larval GFP

g1 (->Large)
Adult

a1 (->Large)


CLOSE