Detailed Information [105007]
 

Strain Information
DGRC Number 105007
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG7979[NP5430] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG7979NP5430 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 66B11
Map Viewer
Related Genes ERR CG7476 CG7979
Original Number 5430
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5430

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1823
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg only.
Larval GFP weak internal
Larval X-gal not in discs. (s.g.)
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np47285_0912
Strand Minus
Insertion Point 8139662
Chromosome Band 3L
Flanking Sequence
gcactgaattaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatgtta
tttcatcatgATATAAACAATACAATTGCGTTATCAGGAGGTGCCAGAGTGGCCAGATGG
CTCAAACGGAATTTCTAAATGAATTAATAATCTAACGCCAGGGAAAAGCTCCCGCCTAAT
TTTNAAATTTACATCAAAAAGTNTCGACAGGCGAACATTTTTGATTTTGGATTNTTAAAT
TATTAAGAAATTGNTAATGGAATTTAGACATTTTTGGNTGGNGGNTCCGGAAGAATNCCA
TTAAGAGAGAAACCCGNCNGCCAAANGAACCCCATTNNTTGGNTGGGGGNCCGNTTTNAA
GGGAAGGGGAAGCCCATTCCGACNATGNTNATTCCTTTTTAGACCCATTNAAAATCCTNN
GAAGAGGCCCNNCCCTGGGCCTTAAAANNCCCNCCGGGANTTGGGGGGGGGTTTTTATTN
GNGANGGCTGNNCGAGGCAAANCNNTTCCNNGNNAANCCNGNGNTTTGGNCCTTTTGGGG
CNNNCCCCCCTTTTNCCCGNGGAGGGANGGGNNNCCCCCTATTTTTTTNGCNGGGNNCNA
AGGGNNGGGNGGGTNTTTAAGCTTNCACTGAGCCCNNTNTTTTTTTTNNGNNGNNNNNNN
NNNNNNNNNNNNNNNTNNNNNNNNNNNNNNTNNNNNNNNTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNTTTTNTNTTNNTN
NNTNNTTNNNNNNNNTNNNNnnnnntnnntnnnntnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnntnnntnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnntnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnntnnntnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntn
nnnnncnnnntnnnnnnnnnnt

Image Files
Adult

a1 (->Large)

a2 (->Large)

CLOSE