Detailed Information [105050]

Strain Information
DGRC Number 105050
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Pabp2[NP5913] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}Pabp2NP5913 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 44B4
Map Viewer
Related Genes CG11508 Pabp2 Obp44a
Original Number 5913
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5913

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 589
General Information NP_lines
Lethality semi lethal
Embryonic Expression stg 17 trachea? May be non-specific.
Larval GFP DT
Larval X-gal checked
Adult GFP internal only
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np47745_0912
Strand Plus
Insertion Point 3192990
Chromosome Band 2R
Flanking Sequence
tttttantttttanagccatttaantgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgTACAAAGCCGAAAACCGCAGCAATGGCTGCCATTTTCA
GAGCGTCACTTCGCACCGCCACTCCATTCCATTGTCTGCTGTGGTTTCGGGCGTTTGCTC
ATCGCTCCAAATCAAATACCCACTAAATTTCATATTTNTCATTNGTCGCCAGGGAGGAGG
GCAGCATGCNAATNGACCCGGAACTGGGANGCCATAAAGGCTTCGANGTCAAGGAGATGG
GAAGANGANGGCCGAGAAGATNAAAGCANATGCNGNCGGAGGTGGGACAAAACAAANTGG
CCNGNGGGGTTNACCACCGGNCTTGGCCACNNGNCCCGCTTTCTTCTTGAGGGGAAAGCA
NGAAANTGACNCCCCGGAACCCGNNNNCCGNGGCNAATGTGGGACTACCGGGCNTTTGGA
CCCGNAGAACCCGGGAGNNCCCCCTTNGNCGGGGTNNGCGGNNCCCTTTAAANCCNGGTN
NNCCCTTTNCTTTTTGANAACAAAGGCCTNGCCNGGNCNCCCCCAAGGGGTNTTGNNNNT
TTCCCATNTNAANNTNGGNTTNNCCNAGGANTAANCTNAAGANAANNNGNNNTTNNNNGT
NTTGAATNATAACCCCNGTTTNNNCNGGGGGCNNTANAAAAACAAGGNGGNNNTATCANG
ATANNCNACANTAAAATNNTTAAAANCACTTANGNATTATNNAAAGCGTNAANGTTTNCC
CTTTTNTTATATTTANTNTNnanaaanttggcnncnngnctgtnngcnnntnttgtngag
nnaccgcnnntgtngttgnnttttnannttctngntnnngtttangtttnctntgntntt
tatgtgnaaaaaggccaacacannnccncaccctgttttnntgnncccctnnnnaccngn
aactannccttttnttttnnnnattancngnncccccttcnnggtgccnctntntnttan
nnancatntnnnnnccannccantnttntntgtnnnntttngtngnnatcttccccttna
tncctttgtaattttatcctcnnnnnntaagncncnnanagnacntaannaanann


CLOSE