Detailed Information [105072]

Strain Information
DGRC Number 105072
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG4318[NP6012] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG4318NP6012 / FM7c
Break points/Insertion Site 11E1
Map Viewer
Related Genes CG4318 CG4332
Original Number 6012
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP6012

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 312
General Information NP_lines
Embryonic Expression weak
Larval GFP sg only.
Larval X-gal sg, CNS
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np42125_0912
Strand Plus
Insertion Point 12885576
Chromosome Band X
Flanking Sequence
tntcaancgtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggacn
accttatgttatttcatcatgGTTTGGAAACACGTGCTAGGAACGACCGTTAGGGACAAT
AAAAACCGATAGTTTTTGAAGCTTTAGATCGAAGANTACATAAGAAGAGAACCGTCGCCA
AAGAACCCATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCC
TCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTG
GAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTA
CTACTCTCTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATA
TCAGTCTCCACTNGNTNNNANNNNNNGGGGGGGNNNNNNNNNNNNNNNNNNNNNANNNNN
NNNNNCNAACNNNNNNNNNNNNNNCNANNNNNNNNNAANNNNNGNNNNANTAANNNNTNT
NCAAAANNNAANNGNNNGGNNGNNNTNNNAGGNNNNNANNTGGAAGNNATNNNNNNNNNN
NNNNNNNNNNNNNNNNNCNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCNNNNNNNNNN
NNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnn


CLOSE