Detailed Information [105101]

Strain Information
DGRC Number 105101
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP6062 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP6062 / FM7c
Break points/Insertion Site 9D3
Map Viewer
Related Genes CG32674 CG32678
Original Number 6062
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP6062

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 263
General Information NP_lines
Embryonic Expression sg
Larval GFP sg, mt, CNS, DT, asp, psp.
Larval X-gal sg only.
Adult GFP ant, lab, probosis. internal thorax, abd.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np42625_0912
Strand Plus
Insertion Point 10325798
Chromosome Band X
Flanking Sequence
nttcgtnnngcgtgacactncaatttttntgtatacttncggtaagcttcggctatcgac
gggaccaccttatgttatttcatcatgTGCGAAACGATGGCGCACAGTGGTCACACTCCT
ACTGAAAACTCTCCATTCAGTTGATGGATAATGTTAAAAGTTCTTTGCGCCACAAGATAT
GTATATGAATCTAAACTATTTATCAATAATAAAAGTATATTAAGAGGTATCTTTAACTTA
ACAGCACAATGGTCGAAGAGTTAAGGAAAGTTGTATCATATGTTTACAGAACATGTTAAC
AGCACTTTACTCCACAAGATATATGAAACCATGGAGTAATAGCTTAATAGTTAAACTATA
TTAAAAAAGAACTTAAACTTAACTCTATTGTGGTCACATGTCAGTCATAAgatcgaagaa
tacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagg
gcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgg
gcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacag
tcaactgtctttgaccctttgttactactctcttccgatgatgatgtcgcacttattcta
tgctgtctcaatgttagaggcatatcagctcgcnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
n


CLOSE