Detailed Information [105126]

Strain Information
DGRC Number 105126
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}NP6100 w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}NP6100 w* / FM7c
Break points/Insertion Site 2E3
Map Viewer
Related Genes CG14052 Vinc
Original Number 6100
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP6100

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 62
General Information NP_lines
Embryonic Expression muscle (weak)
Larval GFP sg, muscles.
Larval X-gal sg, CNS, epi
Adult GFP wing vein, stripe of lsrge cells in abd.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np43935_0912
Flanking Sequence
atcgtangcgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgGNGNAANCANAAANAGNGGNCGNNCGAGCTAGCGAGAA
GCAATAGACNAACAGCAGATAATANCGNCNNNNTANANCAGNGGNNATNATCTNGNNNNA
AGTGGGCNNANAGNCACATNCATTNTATTGNTATGCNAANNNGGNNNGGNTACCNTACNN
NNTTNTTNANANAAATGGGNNGCCTGCATGTNNGANANNAGNTTACACNNCTATNATCTG
NNGGCNGAANCANTNNGTGCCAANNAGCTGCTACNTNNTTGATNTTNTAGNNNTNGAANA
NNACNNCTNNNGGCCTNTGANGCNCACTGACCGCAGACTGTTTGANTGCCNACANNNCAG
TGTGTGCGCGCCCNNCAAATCNAGATCTTTTNTNNNTGTCGANANAGCNCAACGCNTTNA
TNGNCNNNGNGCAGCAAAATCGCGCCAGACAANNTTTNTNNCTNCNGCATCGNCATACGT
ATNGAGGGAGTGATTTCNTTTTTTATGAATTNTNCNNNAACAANCTGGNGATGANNAGCA
GTGAAGCGNTACNTTTNGTTTGTTATTCACTCTGCTTANTNCCATTTCNTTTATGNTATT
GNTGAGGAGCNACCGGGGNGNGAACCAANTGTTGNTGGTGGTGGCCGAGTTGGGGGGGGG
GGGAGTAATNAATNCCGGGTGNCCAANTCGAAAAAGAAAAGCGAGGNAANGTGCNCTGGC
AAAANGATTCCANGGCATGGngggattttanngacagnngncngaccntngcaaagaccc
ntgttntnggggttcgtttnctgatggcaaggattcgccngttttnttttcngccanagt
naggaanccngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaa

Library Name / Clone Name np / np65733_0309
Strand Plus
Insertion Point 1979420
Chromosome Band X
Flanking Sequence
attttgcatgcgcnttatgcagtcatnacgttantggangtctcttgccgacgggcacca
ccttatgttatttcatcatgGTTTCCCCCTTTCTTAGCCGCTGCTTCTTCTTGCCGCTGG
GACTCTGGCCGATGACAGCCAGTGATATCGATAGGCTCCGCATTCTATGAGTGATCCTCT
AGCTAGAGCTTTGCNTACTCGCAAATTATTAAAAATAAAACTTTAAAAATAATTTCGTCT
AATTAATACTATGAGNTAATTCACACCCAACGGACATGATAAGGGTTAATAAACANNANT
ANCGGNTNTGNGNGTNAAACAANATACAAANNTNNGTTCNATNANATNGNNTCNCANNAN
ATNANGCTNTTNATNAANANNNNNNNTNANNNNNNANNNNNNNNNNNNNNNNNNNNNNTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnncn

Image Files
Larval GFP

g1 (->Large)


CLOSE