Detailed Information [105140]
 

Strain Information
DGRC Number 105140
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG32666[NP6127] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG32666NP6127 / FM7c
Break points/Insertion Site 10C1
Map Viewer
Related Genes CG1751 CG32666 Burdock{}107
Original Number 6127
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP6127

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 284
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression epi stripe in stg 11. cns subset later.
Larval GFP strong gut, fb
Larval X-gal sg, gut, mt, fb, stripes in epi,
Adult GFP arista, tarsas, prox leg, eye disc derivative, not lab. large internal cells. abd
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np44315_0912
Strand Plus
Insertion Point 11237140
Chromosome Band X
Flanking Sequence
gtaaacgtgcactgaatttaagtgtatacttcggtaaggcttcggctatcgacgggacca
ccttatgttatttcatcatgGAGCAGCTGTTACCGTTTGCTGGCGAACTGACCCTCATGC
ACCGTCGTCTCTTTCTACGTCCCTCTCTAGGCCCTCTCTCTCTCACACCATATGGTTGGG
ACAGCACTATCTCTTTCTGCCAAGCATTGCTCTCCTTGTCTCGAATGCCCTTTGACTATC
ATTATTTTCAGCTAGATTTGCATTTTGTACCCTTTTTCATCATATACATATACATTTGTA
TATTTTTTTCGCATTGAGCCGTGTTTTTTTGCCTTATTAGTTTTGCATTTCATCGTTTCT
TTAAAGTTCTTTCAGAATCCGCCAACCACAACACCCCACACCCCCTCTTCGCCCCACGAA
GGGTCGTTTGCTTTCGAGCGTTCCGGGGGTTTCATGCTGCCCGGGACCCCATTTATCAAT
CATATTTCCCCCCATTTCTTGGATAAAGCATTTCTGGTATCAGCCAAAAAAATTACCAAA
AAACGAAACGAAAATTAATAATAAAACGTAAATCCCAATCGATGGTTTTGAGTTTCGTAA
GCAGTCAGGGCGTATGAAATAAAATTTTTCTGTCACATCTATCGNTGGGGGGGTCTCAAA
TCGNAATTCTTATCANGAAGCCGTTTGNCCNGAGNGGTTTGGTGNNAAAACCAAAGGCGC
AGGGGNAACCCCCCGGNTNTGAGATGGGNGGNAATNTTTGGCAAAAGGNGGCTTTCAAAA
NACAAACATTTTTAGGNNGGcggncatatcgcanttaaggggnaatggcgatccgaaaaa
tacatnagagaanaaccggcgccnaanaaacccattntgggngggggccccttttcaagg
aagggnn

Image Files
Embryo

e1 (->Large)

CLOSE